Mutagenetix > Incidental Mutation

Incidental Mutation 'R6944:Slc34a2'

540762

Institutional Source

Beutler Lab

Gene Symbol

Slc34a2

Ensembl Gene

ENSMUSG00000029188

Gene Name

solute carrier family 34 (sodium phosphate), member 2

Synonyms

D5Ertd227e, type IIb Na/Picotransporter, Npt2b, NaPi-2b

MMRRC Submission

045058-MU

Accession Numbers

Genbank: NM_011402; MGI: 1342284

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6944 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53038081-53071664 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53064883 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 306 (I306L)

Ref Sequence

ENSEMBL: ENSMUSP00000092380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094787] [ENSMUST00000170523]

AlphaFold

Q9DBP0

Predicted Effect

probably benign
Transcript: ENSMUST00000094787
AA Change: I306L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000092380
Gene: ENSMUSG00000029188
AA Change: I306L

Domain	Start	End	E-Value	Type
Pfam:Na_Pi_cotrans	110	252	2.3e-26	PFAM
Pfam:Na_Pi_cotrans	374	551	2.6e-17	PFAM
low complexity region	553	570	N/A	INTRINSIC
low complexity region	616	645	N/A	INTRINSIC
low complexity region	649	655	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170523

SMART Domains

Protein: ENSMUSP00000130692
Gene: ENSMUSG00000029188

Domain	Start	End	E-Value	Type
Pfam:Na_Pi_cotrans	110	187	2.9e-20	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Phosphate uptake is increased at lower pH. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, embryonic growth arrest, failure of embryo turning and somitogenesis, impaired placental development and impaired yolk sac vascular remodeling. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	C	10: 82,296,222	I318R	probably benign	Het
Abcb1b	T	G	5: 8,813,693	V216G	probably damaging	Het
Abcb5	T	C	12: 118,911,530	R636G	probably benign	Het
Ago1	G	T	4: 126,460,422	F198L	possibly damaging	Het
Ankrd42	C	T	7: 92,619,547		probably null	Het
Anxa11	T	A	14: 25,874,752	F274I	probably damaging	Het
Ascc1	T	C	10: 60,013,653	L122P	probably damaging	Het
Bptf	T	C	11: 107,080,823	S953G	probably damaging	Het
Chml	T	A	1: 175,688,161	N65Y	probably damaging	Het
Clcc1	A	G	3: 108,670,968	K262E	probably damaging	Het
Clhc1	T	G	11: 29,569,346	D384E	probably damaging	Het
Cnot2	G	A	10: 116,537,223		probably benign	Het
Cntnap1	T	C	11: 101,182,904	V627A	probably damaging	Het
Col6a4	A	G	9: 106,072,171	V755A	probably damaging	Het
Cyp4f18	T	A	8: 71,989,894	I406F	probably benign	Het
Dclre1a	T	C	19: 56,545,019	E381G	possibly damaging	Het
Dnah1	A	G	14: 31,268,904	Y3153H	probably damaging	Het
Dnah8	C	A	17: 30,794,659	D3791E	probably benign	Het
Dnah9	T	C	11: 66,085,149	E1358G	possibly damaging	Het
Eef1g	G	A	19: 8,968,292	R30H	probably benign	Het
Egln3	A	T	12: 54,183,952	I181N	probably benign	Het
Entpd6	A	G	2: 150,763,599	T250A	probably damaging	Het
Epb41l5	C	T	1: 119,609,129	R344Q	probably damaging	Het
Fam20b	T	C	1: 156,687,521	D258G	probably benign	Het
Fbxw18	A	T	9: 109,702,587	D21E	probably damaging	Het
Fbxw21	T	C	9: 109,157,535	E92G	probably damaging	Het
Fzd6	T	A	15: 39,025,817	M110K	possibly damaging	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Gm9268	T	C	7: 43,047,969	F817L	possibly damaging	Het
Golgb1	C	T	16: 36,912,113	P574L	probably benign	Het
Gpr153	A	G	4: 152,279,363	E80G	probably damaging	Het
Kcnt1	T	C	2: 25,877,828		probably benign	Het
Kcnt2	T	G	1: 140,584,065	V962G	probably benign	Het
Malt1	T	C	18: 65,437,920	V109A	probably benign	Het
March7	A	G	2: 60,234,243	I288V	probably benign	Het
Mief1	C	T	15: 80,249,443	R234C	probably damaging	Het
Morc3	A	G	16: 93,870,572	S613G	probably benign	Het
Myt1	A	G	2: 181,797,594	E345G	possibly damaging	Het
Napb	T	C	2: 148,706,969	T133A	probably benign	Het
Nwd1	T	C	8: 72,653,534	V16A	possibly damaging	Het
Oas1f	G	A	5: 120,848,184	E67K	probably benign	Het
Obscn	T	C	11: 59,038,930	K5153R	probably damaging	Het
Olfr1441	G	T	19: 12,423,264	M318I	probably benign	Het
Olfr154	C	T	2: 85,663,851	M194I	probably benign	Het
Olfr212	T	C	6: 116,515,830	F18L	possibly damaging	Het
Olfr317	T	A	11: 58,732,242	S308C	possibly damaging	Het
Pdcd2	T	C	17: 15,525,370	N185S	possibly damaging	Het
Pgap1	A	T	1: 54,530,161	W349R	probably damaging	Het
Prpf39	T	A	12: 65,042,680	V64E	probably benign	Het
Ptpn13	T	A	5: 103,476,991	W54R	probably null	Het
Rbms3	G	T	9: 117,110,105	P29Q	probably damaging	Het
Rnf123	A	G	9: 108,063,623	L679P	probably benign	Het
Samd4	T	A	14: 47,016,635	D84E	possibly damaging	Het
Scarf1	T	C	11: 75,522,206	V426A	probably benign	Het
Slc12a1	A	G	2: 125,160,534	N145D	probably damaging	Het
Slc2a6	A	T	2: 27,026,064	M99K	probably damaging	Het
Slx4ip	A	G	2: 137,068,275	K397E	probably damaging	Het
Smr3a	C	T	5: 88,008,090		probably benign	Het
Spef2	T	C	15: 9,592,749	E1502G	probably damaging	Het
Sri	A	T	5: 8,063,365	T119S	probably benign	Het
Synrg	T	A	11: 84,025,086	L1085H	probably damaging	Het
Taf7	A	T	18: 37,642,857	L219H	probably damaging	Het
Tmco3	T	A	8: 13,303,729	V347E	probably damaging	Het
Tmem8b	A	T	4: 43,674,465	I250F	probably damaging	Het
Tom1l2	A	G	11: 60,248,991	V239A	probably damaging	Het
Trpm1	T	A	7: 64,243,433	M1011K	probably damaging	Het
Tspan9	A	T	6: 127,965,806	Y153N	probably benign	Het
Ttll11	T	C	2: 35,752,294	H675R	probably benign	Het
Unc50	C	T	1: 37,432,662	T131M	probably damaging	Het
Vgf	T	A	5: 137,032,352	I456N	probably damaging	Het
Vmn1r223	A	G	13: 23,249,313	I26V	unknown	Het
Vmn1r39	T	C	6: 66,805,221	M1V	probably null	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r14	T	C	5: 109,216,059	T664A	probably benign	Het
Vmn2r14	G	A	5: 109,216,274	T592I	probably benign	Het
Vmn2r96	T	A	17: 18,597,629	F489L	probably benign	Het

Other mutations in Slc34a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00785:Slc34a2	APN	5	53065608	missense	probably benign	0.06
IGL00845:Slc34a2	APN	5	53058354	splice site	probably benign
IGL01024:Slc34a2	APN	5	53067630	missense	possibly damaging	0.61
IGL01300:Slc34a2	APN	5	53068127	critical splice acceptor site	probably null
IGL01680:Slc34a2	APN	5	53060876	missense	probably damaging	1.00
IGL02226:Slc34a2	APN	5	53067731	missense	probably benign	0.12
IGL02682:Slc34a2	APN	5	53059238	missense	possibly damaging	0.64
IGL03294:Slc34a2	APN	5	53063998	missense	probably benign	0.00
tucumcari	UTSW	5	53064009	missense	possibly damaging	0.68
D4216:Slc34a2	UTSW	5	53065497	missense	probably benign	0.01
R0094:Slc34a2	UTSW	5	53063968	missense	probably benign	0.28
R0227:Slc34a2	UTSW	5	53069626	missense	possibly damaging	0.51
R0524:Slc34a2	UTSW	5	53064873	nonsense	probably null
R0836:Slc34a2	UTSW	5	53067707	missense	probably benign
R1525:Slc34a2	UTSW	5	53069506	missense	probably benign	0.00
R1655:Slc34a2	UTSW	5	53069419	missense	probably benign	0.00
R1753:Slc34a2	UTSW	5	53061391	missense	probably benign	0.37
R1838:Slc34a2	UTSW	5	53058436	missense	probably benign
R2361:Slc34a2	UTSW	5	53068145	missense	probably benign	0.10
R2405:Slc34a2	UTSW	5	53058181	missense	probably benign	0.04
R3688:Slc34a2	UTSW	5	53064832	missense	probably benign	0.06
R4108:Slc34a2	UTSW	5	53064009	missense	possibly damaging	0.68
R4176:Slc34a2	UTSW	5	53067568	missense	probably damaging	1.00
R4380:Slc34a2	UTSW	5	53069286	missense	probably damaging	1.00
R4464:Slc34a2	UTSW	5	53069182	missense	probably damaging	0.99
R4780:Slc34a2	UTSW	5	53069451	missense	probably damaging	1.00
R4816:Slc34a2	UTSW	5	53069020	missense	probably damaging	1.00
R4934:Slc34a2	UTSW	5	53067600	missense	probably damaging	1.00
R5265:Slc34a2	UTSW	5	53061434	missense	probably damaging	0.96
R5309:Slc34a2	UTSW	5	53069488	missense	probably damaging	0.96
R5313:Slc34a2	UTSW	5	53069339	missense	probably damaging	0.96
R5884:Slc34a2	UTSW	5	53069380	missense	possibly damaging	0.46
R6084:Slc34a2	UTSW	5	53067647	missense	possibly damaging	0.91
R6310:Slc34a2	UTSW	5	53064797	critical splice acceptor site	probably null
R6568:Slc34a2	UTSW	5	53069134	missense	probably damaging	1.00
R6817:Slc34a2	UTSW	5	53064028	missense	probably damaging	0.98
R6845:Slc34a2	UTSW	5	53069169	missense	probably damaging	0.96
R7873:Slc34a2	UTSW	5	53058372	missense	probably benign	0.02
R8114:Slc34a2	UTSW	5	53068359	missense	probably benign	0.00
R8158:Slc34a2	UTSW	5	53060840	missense	probably damaging	1.00
R8364:Slc34a2	UTSW	5	53068374	missense	possibly damaging	0.75
R9158:Slc34a2	UTSW	5	53063875	missense	possibly damaging	0.95
R9235:Slc34a2	UTSW	5	53069325	missense	probably benign	0.00
R9314:Slc34a2	UTSW	5	53060801	missense	possibly damaging	0.61
Z1176:Slc34a2	UTSW	5	53060817	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGGCTCACATTCACAGCAC -3'
(R):5'- GGCAAGAGTCATCCTTCCATG -3'

Sequencing Primer
(F):5'- TTCACAGCACCCAAAATATCCAAGG -3'
(R):5'- TTATACCACGTCAAGGAGCG -3'

Posted On

2018-11-28