Mutagenetix > Incidental Mutation

Incidental Mutation 'R6944:Trpm1'

540773

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6944 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 64243433 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1011 (M1011K)

Ref Sequence

ENSEMBL: ENSMUSP00000146226 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]

AlphaFold

Q2TV84

Predicted Effect

probably damaging
Transcript: ENSMUST00000085222
AA Change: M1011K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: M1011K

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000206263
AA Change: M895K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206277
AA Change: M1011K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

probably benign
Transcript: ENSMUST00000206848

Meta Mutation Damage Score

0.5810

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	C	10: 82,296,222	I318R	probably benign	Het
Abcb1b	T	G	5: 8,813,693	V216G	probably damaging	Het
Abcb5	T	C	12: 118,911,530	R636G	probably benign	Het
Ago1	G	T	4: 126,460,422	F198L	possibly damaging	Het
Ankrd42	C	T	7: 92,619,547		probably null	Het
Anxa11	T	A	14: 25,874,752	F274I	probably damaging	Het
Ascc1	T	C	10: 60,013,653	L122P	probably damaging	Het
Bptf	T	C	11: 107,080,823	S953G	probably damaging	Het
Chml	T	A	1: 175,688,161	N65Y	probably damaging	Het
Clcc1	A	G	3: 108,670,968	K262E	probably damaging	Het
Clhc1	T	G	11: 29,569,346	D384E	probably damaging	Het
Cnot2	G	A	10: 116,537,223		probably benign	Het
Cntnap1	T	C	11: 101,182,904	V627A	probably damaging	Het
Col6a4	A	G	9: 106,072,171	V755A	probably damaging	Het
Cyp4f18	T	A	8: 71,989,894	I406F	probably benign	Het
Dclre1a	T	C	19: 56,545,019	E381G	possibly damaging	Het
Dnah1	A	G	14: 31,268,904	Y3153H	probably damaging	Het
Dnah8	C	A	17: 30,794,659	D3791E	probably benign	Het
Dnah9	T	C	11: 66,085,149	E1358G	possibly damaging	Het
Eef1g	G	A	19: 8,968,292	R30H	probably benign	Het
Egln3	A	T	12: 54,183,952	I181N	probably benign	Het
Entpd6	A	G	2: 150,763,599	T250A	probably damaging	Het
Epb41l5	C	T	1: 119,609,129	R344Q	probably damaging	Het
Fam20b	T	C	1: 156,687,521	D258G	probably benign	Het
Fbxw18	A	T	9: 109,702,587	D21E	probably damaging	Het
Fbxw21	T	C	9: 109,157,535	E92G	probably damaging	Het
Fzd6	T	A	15: 39,025,817	M110K	possibly damaging	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Gm9268	T	C	7: 43,047,969	F817L	possibly damaging	Het
Golgb1	C	T	16: 36,912,113	P574L	probably benign	Het
Gpr153	A	G	4: 152,279,363	E80G	probably damaging	Het
Kcnt1	T	C	2: 25,877,828		probably benign	Het
Kcnt2	T	G	1: 140,584,065	V962G	probably benign	Het
Malt1	T	C	18: 65,437,920	V109A	probably benign	Het
March7	A	G	2: 60,234,243	I288V	probably benign	Het
Mief1	C	T	15: 80,249,443	R234C	probably damaging	Het
Morc3	A	G	16: 93,870,572	S613G	probably benign	Het
Myt1	A	G	2: 181,797,594	E345G	possibly damaging	Het
Napb	T	C	2: 148,706,969	T133A	probably benign	Het
Nwd1	T	C	8: 72,653,534	V16A	possibly damaging	Het
Oas1f	G	A	5: 120,848,184	E67K	probably benign	Het
Obscn	T	C	11: 59,038,930	K5153R	probably damaging	Het
Olfr1441	G	T	19: 12,423,264	M318I	probably benign	Het
Olfr154	C	T	2: 85,663,851	M194I	probably benign	Het
Olfr212	T	C	6: 116,515,830	F18L	possibly damaging	Het
Olfr317	T	A	11: 58,732,242	S308C	possibly damaging	Het
Pdcd2	T	C	17: 15,525,370	N185S	possibly damaging	Het
Pgap1	A	T	1: 54,530,161	W349R	probably damaging	Het
Prpf39	T	A	12: 65,042,680	V64E	probably benign	Het
Ptpn13	T	A	5: 103,476,991	W54R	probably null	Het
Rbms3	G	T	9: 117,110,105	P29Q	probably damaging	Het
Rnf123	A	G	9: 108,063,623	L679P	probably benign	Het
Samd4	T	A	14: 47,016,635	D84E	possibly damaging	Het
Scarf1	T	C	11: 75,522,206	V426A	probably benign	Het
Slc12a1	A	G	2: 125,160,534	N145D	probably damaging	Het
Slc2a6	A	T	2: 27,026,064	M99K	probably damaging	Het
Slc34a2	A	T	5: 53,064,883	I306L	probably benign	Het
Slx4ip	A	G	2: 137,068,275	K397E	probably damaging	Het
Smr3a	C	T	5: 88,008,090		probably benign	Het
Spef2	T	C	15: 9,592,749	E1502G	probably damaging	Het
Sri	A	T	5: 8,063,365	T119S	probably benign	Het
Synrg	T	A	11: 84,025,086	L1085H	probably damaging	Het
Taf7	A	T	18: 37,642,857	L219H	probably damaging	Het
Tmco3	T	A	8: 13,303,729	V347E	probably damaging	Het
Tmem8b	A	T	4: 43,674,465	I250F	probably damaging	Het
Tom1l2	A	G	11: 60,248,991	V239A	probably damaging	Het
Tspan9	A	T	6: 127,965,806	Y153N	probably benign	Het
Ttll11	T	C	2: 35,752,294	H675R	probably benign	Het
Unc50	C	T	1: 37,432,662	T131M	probably damaging	Het
Vgf	T	A	5: 137,032,352	I456N	probably damaging	Het
Vmn1r223	A	G	13: 23,249,313	I26V	unknown	Het
Vmn1r39	T	C	6: 66,805,221	M1V	probably null	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r14	T	C	5: 109,216,059	T664A	probably benign	Het
Vmn2r14	G	A	5: 109,216,274	T592I	probably benign	Het
Vmn2r96	T	A	17: 18,597,629	F489L	probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GGGTTCTGGAATAACGCAAATGC -3'
(R):5'- AACTGATCATCTGCCCTGGAAG -3'

Sequencing Primer
(F):5'- TGCTTAATAAAGGACATAAAGAGCC -3'
(R):5'- AGGGAAGAGAGTCTTACTATGAATTC -3'

Posted On

2018-11-28