Incidental Mutation 'R6944:Trpm1'
ID540773
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Nametransient receptor potential cation channel, subfamily M, member 1
SynonymsMlsn1, 4732499L03Rik, LTRPC1, melastatin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6944 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location64153835-64269775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64243433 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1011 (M1011K)
Ref Sequence ENSEMBL: ENSMUSP00000146226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]
Predicted Effect probably damaging
Transcript: ENSMUST00000085222
AA Change: M1011K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: M1011K

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000206263
AA Change: M895K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000206277
AA Change: M1011K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206314
Predicted Effect probably benign
Transcript: ENSMUST00000206848
Meta Mutation Damage Score 0.5810 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A C 10: 82,296,222 I318R probably benign Het
Abcb1b T G 5: 8,813,693 V216G probably damaging Het
Abcb5 T C 12: 118,911,530 R636G probably benign Het
Ago1 G T 4: 126,460,422 F198L possibly damaging Het
Ankrd42 C T 7: 92,619,547 probably null Het
Anxa11 T A 14: 25,874,752 F274I probably damaging Het
Ascc1 T C 10: 60,013,653 L122P probably damaging Het
Bptf T C 11: 107,080,823 S953G probably damaging Het
Chml T A 1: 175,688,161 N65Y probably damaging Het
Clcc1 A G 3: 108,670,968 K262E probably damaging Het
Clhc1 T G 11: 29,569,346 D384E probably damaging Het
Cnot2 G A 10: 116,537,223 probably benign Het
Cntnap1 T C 11: 101,182,904 V627A probably damaging Het
Col6a4 A G 9: 106,072,171 V755A probably damaging Het
Cyp4f18 T A 8: 71,989,894 I406F probably benign Het
Dclre1a T C 19: 56,545,019 E381G possibly damaging Het
Dnah1 A G 14: 31,268,904 Y3153H probably damaging Het
Dnah8 C A 17: 30,794,659 D3791E probably benign Het
Dnah9 T C 11: 66,085,149 E1358G possibly damaging Het
Eef1g G A 19: 8,968,292 R30H probably benign Het
Egln3 A T 12: 54,183,952 I181N probably benign Het
Entpd6 A G 2: 150,763,599 T250A probably damaging Het
Epb41l5 C T 1: 119,609,129 R344Q probably damaging Het
Fam20b T C 1: 156,687,521 D258G probably benign Het
Fbxw18 A T 9: 109,702,587 D21E probably damaging Het
Fbxw21 T C 9: 109,157,535 E92G probably damaging Het
Fzd6 T A 15: 39,025,817 M110K possibly damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gm9268 T C 7: 43,047,969 F817L possibly damaging Het
Golgb1 C T 16: 36,912,113 P574L probably benign Het
Gpr153 A G 4: 152,279,363 E80G probably damaging Het
Kcnt1 T C 2: 25,877,828 probably benign Het
Kcnt2 T G 1: 140,584,065 V962G probably benign Het
Malt1 T C 18: 65,437,920 V109A probably benign Het
March7 A G 2: 60,234,243 I288V probably benign Het
Mief1 C T 15: 80,249,443 R234C probably damaging Het
Morc3 A G 16: 93,870,572 S613G probably benign Het
Myt1 A G 2: 181,797,594 E345G possibly damaging Het
Napb T C 2: 148,706,969 T133A probably benign Het
Nwd1 T C 8: 72,653,534 V16A possibly damaging Het
Oas1f G A 5: 120,848,184 E67K probably benign Het
Obscn T C 11: 59,038,930 K5153R probably damaging Het
Olfr1441 G T 19: 12,423,264 M318I probably benign Het
Olfr154 C T 2: 85,663,851 M194I probably benign Het
Olfr212 T C 6: 116,515,830 F18L possibly damaging Het
Olfr317 T A 11: 58,732,242 S308C possibly damaging Het
Pdcd2 T C 17: 15,525,370 N185S possibly damaging Het
Pgap1 A T 1: 54,530,161 W349R probably damaging Het
Prpf39 T A 12: 65,042,680 V64E probably benign Het
Ptpn13 T A 5: 103,476,991 W54R probably null Het
Rbms3 G T 9: 117,110,105 P29Q probably damaging Het
Rnf123 A G 9: 108,063,623 L679P probably benign Het
Samd4 T A 14: 47,016,635 D84E possibly damaging Het
Scarf1 T C 11: 75,522,206 V426A probably benign Het
Slc12a1 A G 2: 125,160,534 N145D probably damaging Het
Slc2a6 A T 2: 27,026,064 M99K probably damaging Het
Slc34a2 A T 5: 53,064,883 I306L probably benign Het
Slx4ip A G 2: 137,068,275 K397E probably damaging Het
Smr3a C T 5: 88,008,090 probably benign Het
Spef2 T C 15: 9,592,749 E1502G probably damaging Het
Sri A T 5: 8,063,365 T119S probably benign Het
Synrg T A 11: 84,025,086 L1085H probably damaging Het
Taf7 A T 18: 37,642,857 L219H probably damaging Het
Tmco3 T A 8: 13,303,729 V347E probably damaging Het
Tmem8b A T 4: 43,674,465 I250F probably damaging Het
Tom1l2 A G 11: 60,248,991 V239A probably damaging Het
Tspan9 A T 6: 127,965,806 Y153N probably benign Het
Ttll11 T C 2: 35,752,294 H675R probably benign Het
Unc50 C T 1: 37,432,662 T131M probably damaging Het
Vgf T A 5: 137,032,352 I456N probably damaging Het
Vmn1r223 A G 13: 23,249,313 I26V unknown Het
Vmn1r39 T C 6: 66,805,221 M1V probably null Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r14 T C 5: 109,216,059 T664A probably benign Het
Vmn2r14 G A 5: 109,216,274 T592I probably benign Het
Vmn2r96 T A 17: 18,597,629 F489L probably benign Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 64243450 missense probably damaging 1.00
IGL00465:Trpm1 APN 7 64247467 missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 64235824 missense probably benign 0.24
IGL01148:Trpm1 APN 7 64243564 missense probably damaging 1.00
IGL01303:Trpm1 APN 7 64210830 critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 64235019 missense probably benign 0.18
IGL01433:Trpm1 APN 7 64204528 missense probably damaging 1.00
IGL01506:Trpm1 APN 7 64243581 missense probably damaging 1.00
IGL01626:Trpm1 APN 7 64268889 missense probably damaging 1.00
IGL01640:Trpm1 APN 7 64226897 missense probably damaging 1.00
IGL01899:Trpm1 APN 7 64234994 missense probably benign 0.24
IGL01959:Trpm1 APN 7 64208975 missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 64210865 missense probably damaging 1.00
IGL02268:Trpm1 APN 7 64217614 missense probably damaging 0.96
IGL02331:Trpm1 APN 7 64235052 missense probably benign 0.30
IGL02334:Trpm1 APN 7 64245942 critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 64219121 missense probably damaging 1.00
IGL02425:Trpm1 APN 7 64240427 missense probably damaging 0.96
IGL02485:Trpm1 APN 7 64269114 missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 64199224 missense probably benign 0.00
IGL02640:Trpm1 APN 7 64219133 missense probably damaging 0.97
IGL02827:Trpm1 APN 7 64219160 missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 64268561 missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 64199250 intron probably benign
R0012:Trpm1 UTSW 7 64268591 missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 64248222 missense probably damaging 1.00
R0056:Trpm1 UTSW 7 64243586 missense probably damaging 1.00
R0445:Trpm1 UTSW 7 64244842 unclassified probably benign
R0463:Trpm1 UTSW 7 64220254 missense probably benign 0.05
R0469:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R0510:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R1301:Trpm1 UTSW 7 64203053 splice site probably null
R1397:Trpm1 UTSW 7 64217658 missense probably damaging 1.00
R1588:Trpm1 UTSW 7 64223817 missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 64240535 missense probably damaging 1.00
R1724:Trpm1 UTSW 7 64235821 nonsense probably null
R1827:Trpm1 UTSW 7 64235007 missense probably damaging 1.00
R1829:Trpm1 UTSW 7 64226782 missense probably damaging 1.00
R1835:Trpm1 UTSW 7 64230268 missense probably damaging 1.00
R1864:Trpm1 UTSW 7 64268016 missense probably damaging 1.00
R1895:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1946:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1959:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1960:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1980:Trpm1 UTSW 7 64208434 missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 64209032 intron probably null
R2054:Trpm1 UTSW 7 64240555 missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 64234988 missense probably damaging 1.00
R2251:Trpm1 UTSW 7 64209976 missense probably damaging 1.00
R3051:Trpm1 UTSW 7 64269101 missense probably damaging 1.00
R3148:Trpm1 UTSW 7 64235012 missense probably benign 0.00
R3195:Trpm1 UTSW 7 64199313 nonsense probably null
R3615:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3616:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3623:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3624:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3721:Trpm1 UTSW 7 64217727 intron probably benign
R3822:Trpm1 UTSW 7 64217703 intron probably benign
R4441:Trpm1 UTSW 7 64201918 missense probably damaging 1.00
R4490:Trpm1 UTSW 7 64208912 nonsense probably null
R4666:Trpm1 UTSW 7 64203034 missense probably damaging 1.00
R4701:Trpm1 UTSW 7 64243500 missense probably damaging 1.00
R4781:Trpm1 UTSW 7 64235052 missense probably benign 0.30
R4811:Trpm1 UTSW 7 64208306 missense probably damaging 1.00
R5017:Trpm1 UTSW 7 64244832 unclassified probably benign
R5030:Trpm1 UTSW 7 64235831 missense probably damaging 1.00
R5195:Trpm1 UTSW 7 64237693 missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 64268954 missense probably damaging 1.00
R5304:Trpm1 UTSW 7 64208946 missense probably benign 0.00
R5575:Trpm1 UTSW 7 64220270 missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 64208411 missense probably damaging 1.00
R5855:Trpm1 UTSW 7 64268962 nonsense probably null
R5947:Trpm1 UTSW 7 64223799 missense probably benign 0.07
R5988:Trpm1 UTSW 7 64226805 missense probably benign 0.16
R6054:Trpm1 UTSW 7 64268702 missense probably benign 0.00
R6088:Trpm1 UTSW 7 64267976 missense probably damaging 0.98
R6259:Trpm1 UTSW 7 64268478 missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 64199194 missense probably benign 0.00
R6380:Trpm1 UTSW 7 64268297 missense probably benign 0.24
R6429:Trpm1 UTSW 7 64268504 missense probably benign 0.00
R6600:Trpm1 UTSW 7 64154033 start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 64240595 missense probably damaging 0.96
R6939:Trpm1 UTSW 7 64268297 missense probably benign 0.03
R7025:Trpm1 UTSW 7 64226714 critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 64235845 missense probably damaging 0.97
R7168:Trpm1 UTSW 7 64268697 missense probably benign 0.01
R7219:Trpm1 UTSW 7 64204585 missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 64219106 critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 64209981 nonsense probably null
R7367:Trpm1 UTSW 7 64268801 missense probably benign 0.06
R7449:Trpm1 UTSW 7 64208975 missense probably benign 0.14
R7466:Trpm1 UTSW 7 64240582 missense probably damaging 0.99
R7498:Trpm1 UTSW 7 64208909 missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 64204555 missense probably benign 0.00
R7776:Trpm1 UTSW 7 64248191 missense probably benign 0.04
R8062:Trpm1 UTSW 7 64201941 missense probably benign 0.18
R8069:Trpm1 UTSW 7 64208970 missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 64199269 missense probably damaging 1.00
R8219:Trpm1 UTSW 7 64201951 missense probably benign 0.35
R8258:Trpm1 UTSW 7 64269029 missense probably benign 0.10
R8259:Trpm1 UTSW 7 64269029 missense probably benign 0.10
R8320:Trpm1 UTSW 7 64268793 missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 64247407 missense probably damaging 1.00
R8544:Trpm1 UTSW 7 64224608 splice site probably null
R8813:Trpm1 UTSW 7 64202008 missense possibly damaging 0.68
X0026:Trpm1 UTSW 7 64268910 missense probably benign 0.05
Z1176:Trpm1 UTSW 7 64203131 critical splice donor site probably null
Z1176:Trpm1 UTSW 7 64204594 critical splice donor site probably null
Z1177:Trpm1 UTSW 7 64217691 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGTTCTGGAATAACGCAAATGC -3'
(R):5'- AACTGATCATCTGCCCTGGAAG -3'

Sequencing Primer
(F):5'- TGCTTAATAAAGGACATAAAGAGCC -3'
(R):5'- AGGGAAGAGAGTCTTACTATGAATTC -3'
Posted On2018-11-28