Incidental Mutation 'R6944:Ankrd42'
ID540774
Institutional Source Beutler Lab
Gene Symbol Ankrd42
Ensembl Gene ENSMUSG00000041343
Gene Nameankyrin repeat domain 42
Synonyms4933417L02Rik, Ikbn
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6944 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location92581723-92637142 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 92619547 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056106] [ENSMUST00000118157] [ENSMUST00000126305] [ENSMUST00000138267] [ENSMUST00000207131] [ENSMUST00000207151]
Predicted Effect probably null
Transcript: ENSMUST00000056106
SMART Domains Protein: ENSMUSP00000061208
Gene: ENSMUSG00000041343

DomainStartEndE-ValueType
ANK 25 54 1.1e2 SMART
ANK 59 88 7.3e-3 SMART
ANK 92 121 6.71e-2 SMART
ANK 125 154 1.48e-3 SMART
ANK 158 187 2.11e2 SMART
ANK 191 220 9.78e-4 SMART
ANK 263 293 1.33e2 SMART
ANK 297 326 1.22e-4 SMART
coiled coil region 437 489 N/A INTRINSIC
low complexity region 494 507 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118157
SMART Domains Protein: ENSMUSP00000113767
Gene: ENSMUSG00000041343

DomainStartEndE-ValueType
ANK 25 54 1.1e2 SMART
ANK 59 88 7.3e-3 SMART
ANK 92 121 6.71e-2 SMART
ANK 125 154 1.48e-3 SMART
ANK 158 187 2.11e2 SMART
ANK 191 220 9.78e-4 SMART
ANK 263 293 1.33e2 SMART
ANK 297 326 1.22e-4 SMART
coiled coil region 437 489 N/A INTRINSIC
low complexity region 494 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126305
SMART Domains Protein: ENSMUSP00000123315
Gene: ENSMUSG00000041343

DomainStartEndE-ValueType
ANK 25 54 1.1e2 SMART
ANK 59 88 7.3e-3 SMART
ANK 92 121 6.71e-2 SMART
ANK 125 154 2.92e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138267
Predicted Effect probably null
Transcript: ENSMUST00000207131
Predicted Effect probably benign
Transcript: ENSMUST00000207151
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 97% (75/77)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A C 10: 82,296,222 I318R probably benign Het
Abcb1b T G 5: 8,813,693 V216G probably damaging Het
Abcb5 T C 12: 118,911,530 R636G probably benign Het
Ago1 G T 4: 126,460,422 F198L possibly damaging Het
Anxa11 T A 14: 25,874,752 F274I probably damaging Het
Ascc1 T C 10: 60,013,653 L122P probably damaging Het
Bptf T C 11: 107,080,823 S953G probably damaging Het
Chml T A 1: 175,688,161 N65Y probably damaging Het
Clcc1 A G 3: 108,670,968 K262E probably damaging Het
Clhc1 T G 11: 29,569,346 D384E probably damaging Het
Cnot2 G A 10: 116,537,223 probably benign Het
Cntnap1 T C 11: 101,182,904 V627A probably damaging Het
Col6a4 A G 9: 106,072,171 V755A probably damaging Het
Cyp4f18 T A 8: 71,989,894 I406F probably benign Het
Dclre1a T C 19: 56,545,019 E381G possibly damaging Het
Dnah1 A G 14: 31,268,904 Y3153H probably damaging Het
Dnah8 C A 17: 30,794,659 D3791E probably benign Het
Dnah9 T C 11: 66,085,149 E1358G possibly damaging Het
Eef1g G A 19: 8,968,292 R30H probably benign Het
Egln3 A T 12: 54,183,952 I181N probably benign Het
Entpd6 A G 2: 150,763,599 T250A probably damaging Het
Epb41l5 C T 1: 119,609,129 R344Q probably damaging Het
Fam20b T C 1: 156,687,521 D258G probably benign Het
Fbxw18 A T 9: 109,702,587 D21E probably damaging Het
Fbxw21 T C 9: 109,157,535 E92G probably damaging Het
Fzd6 T A 15: 39,025,817 M110K possibly damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gm9268 T C 7: 43,047,969 F817L possibly damaging Het
Golgb1 C T 16: 36,912,113 P574L probably benign Het
Gpr153 A G 4: 152,279,363 E80G probably damaging Het
Kcnt1 T C 2: 25,877,828 probably benign Het
Kcnt2 T G 1: 140,584,065 V962G probably benign Het
Malt1 T C 18: 65,437,920 V109A probably benign Het
March7 A G 2: 60,234,243 I288V probably benign Het
Mief1 C T 15: 80,249,443 R234C probably damaging Het
Morc3 A G 16: 93,870,572 S613G probably benign Het
Myt1 A G 2: 181,797,594 E345G possibly damaging Het
Napb T C 2: 148,706,969 T133A probably benign Het
Nwd1 T C 8: 72,653,534 V16A possibly damaging Het
Oas1f G A 5: 120,848,184 E67K probably benign Het
Obscn T C 11: 59,038,930 K5153R probably damaging Het
Olfr1441 G T 19: 12,423,264 M318I probably benign Het
Olfr154 C T 2: 85,663,851 M194I probably benign Het
Olfr212 T C 6: 116,515,830 F18L possibly damaging Het
Olfr317 T A 11: 58,732,242 S308C possibly damaging Het
Pdcd2 T C 17: 15,525,370 N185S possibly damaging Het
Pgap1 A T 1: 54,530,161 W349R probably damaging Het
Prpf39 T A 12: 65,042,680 V64E probably benign Het
Ptpn13 T A 5: 103,476,991 W54R probably null Het
Rbms3 G T 9: 117,110,105 P29Q probably damaging Het
Rnf123 A G 9: 108,063,623 L679P probably benign Het
Samd4 T A 14: 47,016,635 D84E possibly damaging Het
Scarf1 T C 11: 75,522,206 V426A probably benign Het
Slc12a1 A G 2: 125,160,534 N145D probably damaging Het
Slc2a6 A T 2: 27,026,064 M99K probably damaging Het
Slc34a2 A T 5: 53,064,883 I306L probably benign Het
Slx4ip A G 2: 137,068,275 K397E probably damaging Het
Smr3a C T 5: 88,008,090 probably benign Het
Spef2 T C 15: 9,592,749 E1502G probably damaging Het
Sri A T 5: 8,063,365 T119S probably benign Het
Synrg T A 11: 84,025,086 L1085H probably damaging Het
Taf7 A T 18: 37,642,857 L219H probably damaging Het
Tmco3 T A 8: 13,303,729 V347E probably damaging Het
Tmem8b A T 4: 43,674,465 I250F probably damaging Het
Tom1l2 A G 11: 60,248,991 V239A probably damaging Het
Trpm1 T A 7: 64,243,433 M1011K probably damaging Het
Tspan9 A T 6: 127,965,806 Y153N probably benign Het
Ttll11 T C 2: 35,752,294 H675R probably benign Het
Unc50 C T 1: 37,432,662 T131M probably damaging Het
Vgf T A 5: 137,032,352 I456N probably damaging Het
Vmn1r223 A G 13: 23,249,313 I26V unknown Het
Vmn1r39 T C 6: 66,805,221 M1V probably null Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r14 T C 5: 109,216,059 T664A probably benign Het
Vmn2r14 G A 5: 109,216,274 T592I probably benign Het
Vmn2r96 T A 17: 18,597,629 F489L probably benign Het
Other mutations in Ankrd42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ankrd42 APN 7 92584454 utr 3 prime probably benign
IGL01151:Ankrd42 APN 7 92605200 unclassified probably benign
IGL01444:Ankrd42 APN 7 92610585 missense probably damaging 0.96
IGL01933:Ankrd42 APN 7 92605285 missense probably benign
IGL03195:Ankrd42 APN 7 92591858 missense probably benign 0.33
IGL03397:Ankrd42 APN 7 92619554 missense probably damaging 1.00
R0128:Ankrd42 UTSW 7 92591859 nonsense probably null
R0278:Ankrd42 UTSW 7 92631657 missense possibly damaging 0.82
R0839:Ankrd42 UTSW 7 92612772 missense possibly damaging 0.92
R1227:Ankrd42 UTSW 7 92605300 missense possibly damaging 0.53
R1603:Ankrd42 UTSW 7 92619691 intron probably benign
R2281:Ankrd42 UTSW 7 92625773 nonsense probably null
R2299:Ankrd42 UTSW 7 92590254 missense probably benign 0.33
R2324:Ankrd42 UTSW 7 92623978 missense probably damaging 0.98
R2874:Ankrd42 UTSW 7 92605358 missense possibly damaging 0.71
R3940:Ankrd42 UTSW 7 92591788 splice site probably null
R4998:Ankrd42 UTSW 7 92624074 missense possibly damaging 0.71
R5579:Ankrd42 UTSW 7 92590182 missense possibly damaging 0.96
R5954:Ankrd42 UTSW 7 92623967 critical splice donor site probably null
R6140:Ankrd42 UTSW 7 92591828 splice site probably null
R6924:Ankrd42 UTSW 7 92582016 unclassified probably benign
R7096:Ankrd42 UTSW 7 92591832 nonsense probably null
R7101:Ankrd42 UTSW 7 92631544 missense possibly damaging 0.53
R7155:Ankrd42 UTSW 7 92591933 missense possibly damaging 0.72
R7410:Ankrd42 UTSW 7 92610554 missense possibly damaging 0.93
R7500:Ankrd42 UTSW 7 92591872 missense probably benign 0.33
R7640:Ankrd42 UTSW 7 92619635 missense probably benign 0.14
R7737:Ankrd42 UTSW 7 92605262 missense possibly damaging 0.53
R8669:Ankrd42 UTSW 7 92619673 missense possibly damaging 0.51
R8794:Ankrd42 UTSW 7 92614466 missense probably benign 0.32
X0065:Ankrd42 UTSW 7 92610555 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAACTGCTGAGATGGCTCAC -3'
(R):5'- CCATTTTCCTTACCAATGGCAG -3'

Sequencing Primer
(F):5'- AGCAGGTCACATCAGCTT -3'
(R):5'- GGAAACTGAGTCCATTTTGAAACCG -3'
Posted On2018-11-28