Incidental Mutation 'R6944:Cyp4f18'
ID540777
Institutional Source Beutler Lab
Gene Symbol Cyp4f18
Ensembl Gene ENSMUSG00000003484
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 18
Synonyms1810054N16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6944 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location71988482-72009626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71989894 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 406 (I406F)
Ref Sequence ENSEMBL: ENSMUSP00000003574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003574]
Predicted Effect probably benign
Transcript: ENSMUST00000003574
AA Change: I406F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000003574
Gene: ENSMUSG00000003484
AA Change: I406F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 52 516 2.7e-132 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. The enzyme starts the process of inactivating and degrading leukotriene B4, a potent mediator of inflammation. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F11, is approximately 16 kb away. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered leukotriene B4 metabolism but show no significant alterations in inflammatory cell infiltration or injury following renal ischemia-reperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A C 10: 82,296,222 I318R probably benign Het
Abcb1b T G 5: 8,813,693 V216G probably damaging Het
Abcb5 T C 12: 118,911,530 R636G probably benign Het
Ago1 G T 4: 126,460,422 F198L possibly damaging Het
Ankrd42 C T 7: 92,619,547 probably null Het
Anxa11 T A 14: 25,874,752 F274I probably damaging Het
Ascc1 T C 10: 60,013,653 L122P probably damaging Het
Bptf T C 11: 107,080,823 S953G probably damaging Het
Chml T A 1: 175,688,161 N65Y probably damaging Het
Clcc1 A G 3: 108,670,968 K262E probably damaging Het
Clhc1 T G 11: 29,569,346 D384E probably damaging Het
Cnot2 G A 10: 116,537,223 probably benign Het
Cntnap1 T C 11: 101,182,904 V627A probably damaging Het
Col6a4 A G 9: 106,072,171 V755A probably damaging Het
Dclre1a T C 19: 56,545,019 E381G possibly damaging Het
Dnah1 A G 14: 31,268,904 Y3153H probably damaging Het
Dnah8 C A 17: 30,794,659 D3791E probably benign Het
Dnah9 T C 11: 66,085,149 E1358G possibly damaging Het
Eef1g G A 19: 8,968,292 R30H probably benign Het
Egln3 A T 12: 54,183,952 I181N probably benign Het
Entpd6 A G 2: 150,763,599 T250A probably damaging Het
Epb41l5 C T 1: 119,609,129 R344Q probably damaging Het
Fam20b T C 1: 156,687,521 D258G probably benign Het
Fbxw18 A T 9: 109,702,587 D21E probably damaging Het
Fbxw21 T C 9: 109,157,535 E92G probably damaging Het
Fzd6 T A 15: 39,025,817 M110K possibly damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gm9268 T C 7: 43,047,969 F817L possibly damaging Het
Golgb1 C T 16: 36,912,113 P574L probably benign Het
Gpr153 A G 4: 152,279,363 E80G probably damaging Het
Kcnt1 T C 2: 25,877,828 probably benign Het
Kcnt2 T G 1: 140,584,065 V962G probably benign Het
Malt1 T C 18: 65,437,920 V109A probably benign Het
March7 A G 2: 60,234,243 I288V probably benign Het
Mief1 C T 15: 80,249,443 R234C probably damaging Het
Morc3 A G 16: 93,870,572 S613G probably benign Het
Myt1 A G 2: 181,797,594 E345G possibly damaging Het
Napb T C 2: 148,706,969 T133A probably benign Het
Nwd1 T C 8: 72,653,534 V16A possibly damaging Het
Oas1f G A 5: 120,848,184 E67K probably benign Het
Obscn T C 11: 59,038,930 K5153R probably damaging Het
Olfr1441 G T 19: 12,423,264 M318I probably benign Het
Olfr154 C T 2: 85,663,851 M194I probably benign Het
Olfr212 T C 6: 116,515,830 F18L possibly damaging Het
Olfr317 T A 11: 58,732,242 S308C possibly damaging Het
Pdcd2 T C 17: 15,525,370 N185S possibly damaging Het
Pgap1 A T 1: 54,530,161 W349R probably damaging Het
Prpf39 T A 12: 65,042,680 V64E probably benign Het
Ptpn13 T A 5: 103,476,991 W54R probably null Het
Rbms3 G T 9: 117,110,105 P29Q probably damaging Het
Rnf123 A G 9: 108,063,623 L679P probably benign Het
Samd4 T A 14: 47,016,635 D84E possibly damaging Het
Scarf1 T C 11: 75,522,206 V426A probably benign Het
Slc12a1 A G 2: 125,160,534 N145D probably damaging Het
Slc2a6 A T 2: 27,026,064 M99K probably damaging Het
Slc34a2 A T 5: 53,064,883 I306L probably benign Het
Slx4ip A G 2: 137,068,275 K397E probably damaging Het
Smr3a C T 5: 88,008,090 probably benign Het
Spef2 T C 15: 9,592,749 E1502G probably damaging Het
Sri A T 5: 8,063,365 T119S probably benign Het
Synrg T A 11: 84,025,086 L1085H probably damaging Het
Taf7 A T 18: 37,642,857 L219H probably damaging Het
Tmco3 T A 8: 13,303,729 V347E probably damaging Het
Tmem8b A T 4: 43,674,465 I250F probably damaging Het
Tom1l2 A G 11: 60,248,991 V239A probably damaging Het
Trpm1 T A 7: 64,243,433 M1011K probably damaging Het
Tspan9 A T 6: 127,965,806 Y153N probably benign Het
Ttll11 T C 2: 35,752,294 H675R probably benign Het
Unc50 C T 1: 37,432,662 T131M probably damaging Het
Vgf T A 5: 137,032,352 I456N probably damaging Het
Vmn1r223 A G 13: 23,249,313 I26V unknown Het
Vmn1r39 T C 6: 66,805,221 M1V probably null Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r14 T C 5: 109,216,059 T664A probably benign Het
Vmn2r14 G A 5: 109,216,274 T592I probably benign Het
Vmn2r96 T A 17: 18,597,629 F489L probably benign Het
Other mutations in Cyp4f18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Cyp4f18 APN 8 71989927 missense probably damaging 0.96
IGL01465:Cyp4f18 APN 8 72002444 missense probably benign
IGL01863:Cyp4f18 APN 8 71989926 missense possibly damaging 0.49
IGL02403:Cyp4f18 APN 8 71998228 missense probably damaging 0.97
IGL03244:Cyp4f18 APN 8 71988645 missense probably benign 0.12
R0226:Cyp4f18 UTSW 8 71989775 splice site probably benign
R0310:Cyp4f18 UTSW 8 72001012 splice site probably benign
R0486:Cyp4f18 UTSW 8 71996017 missense probably benign 0.02
R0506:Cyp4f18 UTSW 8 71996000 missense probably benign 0.00
R0547:Cyp4f18 UTSW 8 71996010 missense probably benign 0.00
R0689:Cyp4f18 UTSW 8 71995968 missense probably benign
R0721:Cyp4f18 UTSW 8 72001135 missense probably benign 0.02
R1534:Cyp4f18 UTSW 8 71992955 missense probably damaging 1.00
R2087:Cyp4f18 UTSW 8 72000988 missense probably benign
R2902:Cyp4f18 UTSW 8 72002411 missense probably damaging 0.96
R3149:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3150:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3177:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3277:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3906:Cyp4f18 UTSW 8 72001082 splice site probably benign
R3916:Cyp4f18 UTSW 8 71996037 missense probably benign 0.03
R3953:Cyp4f18 UTSW 8 72000957 missense probably damaging 1.00
R4815:Cyp4f18 UTSW 8 71995995 missense possibly damaging 0.52
R4915:Cyp4f18 UTSW 8 72009054 missense probably damaging 1.00
R5086:Cyp4f18 UTSW 8 72002432 missense probably benign 0.00
R5113:Cyp4f18 UTSW 8 71989058 critical splice donor site probably null
R5202:Cyp4f18 UTSW 8 72009096 missense probably benign 0.03
R5761:Cyp4f18 UTSW 8 71996131 missense probably damaging 0.99
R6187:Cyp4f18 UTSW 8 71993186 missense probably damaging 0.98
R6664:Cyp4f18 UTSW 8 71989915 missense probably benign 0.21
R6978:Cyp4f18 UTSW 8 72002496 missense probably benign
R7288:Cyp4f18 UTSW 8 71993173 missense probably damaging 1.00
R7326:Cyp4f18 UTSW 8 71988654 missense probably benign 0.14
R7432:Cyp4f18 UTSW 8 71996062 missense probably benign 0.00
R7871:Cyp4f18 UTSW 8 71988643 missense possibly damaging 0.69
R8063:Cyp4f18 UTSW 8 71998231 missense probably damaging 1.00
R8272:Cyp4f18 UTSW 8 71989091 missense probably benign 0.44
R8321:Cyp4f18 UTSW 8 71988583 missense possibly damaging 0.88
Z1177:Cyp4f18 UTSW 8 71998283 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTAAGAGGGACAGCACCTCC -3'
(R):5'- CCATCTTAGCACTTAAAACAGGG -3'

Sequencing Primer
(F):5'- GTCTGGCCACACAGCTG -3'
(R):5'- GCATTAAGGAGAGCCTACG -3'
Posted On2018-11-28