Mutagenetix > Incidental Mutations

Incidental Mutation 'R6944:Cyp4f18'

540777

Institutional Source

Beutler Lab

Gene Symbol

Cyp4f18

Ensembl Gene

ENSMUSG00000003484

Gene Name

cytochrome P450, family 4, subfamily f, polypeptide 18

Synonyms

1810054N16Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6944 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71988482-72009626 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 71989894 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 406 (I406F)

Ref Sequence

ENSEMBL: ENSMUSP00000003574 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003574]

Predicted Effect

probably benign
Transcript: ENSMUST00000003574
AA Change: I406F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000003574
Gene: ENSMUSG00000003484
AA Change: I406F

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:p450	52	516	2.7e-132	PFAM

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. The enzyme starts the process of inactivating and degrading leukotriene B4, a potent mediator of inflammation. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F11, is approximately 16 kb away. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered leukotriene B4 metabolism but show no significant alterations in inflammatory cell infiltration or injury following renal ischemia-reperfusion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	C	10: 82,296,222	I318R	probably benign	Het
Abcb1b	T	G	5: 8,813,693	V216G	probably damaging	Het
Abcb5	T	C	12: 118,911,530	R636G	probably benign	Het
Ago1	G	T	4: 126,460,422	F198L	possibly damaging	Het
Ankrd42	C	T	7: 92,619,547		probably null	Het
Anxa11	T	A	14: 25,874,752	F274I	probably damaging	Het
Ascc1	T	C	10: 60,013,653	L122P	probably damaging	Het
Bptf	T	C	11: 107,080,823	S953G	probably damaging	Het
Chml	T	A	1: 175,688,161	N65Y	probably damaging	Het
Clcc1	A	G	3: 108,670,968	K262E	probably damaging	Het
Clhc1	T	G	11: 29,569,346	D384E	probably damaging	Het
Cnot2	G	A	10: 116,537,223		probably benign	Het
Cntnap1	T	C	11: 101,182,904	V627A	probably damaging	Het
Col6a4	A	G	9: 106,072,171	V755A	probably damaging	Het
Dclre1a	T	C	19: 56,545,019	E381G	possibly damaging	Het
Dnah1	A	G	14: 31,268,904	Y3153H	probably damaging	Het
Dnah8	C	A	17: 30,794,659	D3791E	probably benign	Het
Dnah9	T	C	11: 66,085,149	E1358G	possibly damaging	Het
Eef1g	G	A	19: 8,968,292	R30H	probably benign	Het
Egln3	A	T	12: 54,183,952	I181N	probably benign	Het
Entpd6	A	G	2: 150,763,599	T250A	probably damaging	Het
Epb41l5	C	T	1: 119,609,129	R344Q	probably damaging	Het
Fam20b	T	C	1: 156,687,521	D258G	probably benign	Het
Fbxw18	A	T	9: 109,702,587	D21E	probably damaging	Het
Fbxw21	T	C	9: 109,157,535	E92G	probably damaging	Het
Fzd6	T	A	15: 39,025,817	M110K	possibly damaging	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Gm9268	T	C	7: 43,047,969	F817L	possibly damaging	Het
Golgb1	C	T	16: 36,912,113	P574L	probably benign	Het
Gpr153	A	G	4: 152,279,363	E80G	probably damaging	Het
Kcnt1	T	C	2: 25,877,828		probably benign	Het
Kcnt2	T	G	1: 140,584,065	V962G	probably benign	Het
Malt1	T	C	18: 65,437,920	V109A	probably benign	Het
March7	A	G	2: 60,234,243	I288V	probably benign	Het
Mief1	C	T	15: 80,249,443	R234C	probably damaging	Het
Morc3	A	G	16: 93,870,572	S613G	probably benign	Het
Myt1	A	G	2: 181,797,594	E345G	possibly damaging	Het
Napb	T	C	2: 148,706,969	T133A	probably benign	Het
Nwd1	T	C	8: 72,653,534	V16A	possibly damaging	Het
Oas1f	G	A	5: 120,848,184	E67K	probably benign	Het
Obscn	T	C	11: 59,038,930	K5153R	probably damaging	Het
Olfr1441	G	T	19: 12,423,264	M318I	probably benign	Het
Olfr154	C	T	2: 85,663,851	M194I	probably benign	Het
Olfr212	T	C	6: 116,515,830	F18L	possibly damaging	Het
Olfr317	T	A	11: 58,732,242	S308C	possibly damaging	Het
Pdcd2	T	C	17: 15,525,370	N185S	possibly damaging	Het
Pgap1	A	T	1: 54,530,161	W349R	probably damaging	Het
Prpf39	T	A	12: 65,042,680	V64E	probably benign	Het
Ptpn13	T	A	5: 103,476,991	W54R	probably null	Het
Rbms3	G	T	9: 117,110,105	P29Q	probably damaging	Het
Rnf123	A	G	9: 108,063,623	L679P	probably benign	Het
Samd4	T	A	14: 47,016,635	D84E	possibly damaging	Het
Scarf1	T	C	11: 75,522,206	V426A	probably benign	Het
Slc12a1	A	G	2: 125,160,534	N145D	probably damaging	Het
Slc2a6	A	T	2: 27,026,064	M99K	probably damaging	Het
Slc34a2	A	T	5: 53,064,883	I306L	probably benign	Het
Slx4ip	A	G	2: 137,068,275	K397E	probably damaging	Het
Smr3a	C	T	5: 88,008,090		probably benign	Het
Spef2	T	C	15: 9,592,749	E1502G	probably damaging	Het
Sri	A	T	5: 8,063,365	T119S	probably benign	Het
Synrg	T	A	11: 84,025,086	L1085H	probably damaging	Het
Taf7	A	T	18: 37,642,857	L219H	probably damaging	Het
Tmco3	T	A	8: 13,303,729	V347E	probably damaging	Het
Tmem8b	A	T	4: 43,674,465	I250F	probably damaging	Het
Tom1l2	A	G	11: 60,248,991	V239A	probably damaging	Het
Trpm1	T	A	7: 64,243,433	M1011K	probably damaging	Het
Tspan9	A	T	6: 127,965,806	Y153N	probably benign	Het
Ttll11	T	C	2: 35,752,294	H675R	probably benign	Het
Unc50	C	T	1: 37,432,662	T131M	probably damaging	Het
Vgf	T	A	5: 137,032,352	I456N	probably damaging	Het
Vmn1r223	A	G	13: 23,249,313	I26V	unknown	Het
Vmn1r39	T	C	6: 66,805,221	M1V	probably null	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r14	T	C	5: 109,216,059	T664A	probably benign	Het
Vmn2r14	G	A	5: 109,216,274	T592I	probably benign	Het
Vmn2r96	T	A	17: 18,597,629	F489L	probably benign	Het

Other mutations in Cyp4f18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Cyp4f18	APN	8	71989927	missense	probably damaging	0.96
IGL01465:Cyp4f18	APN	8	72002444	missense	probably benign
IGL01863:Cyp4f18	APN	8	71989926	missense	possibly damaging	0.49
IGL02403:Cyp4f18	APN	8	71998228	missense	probably damaging	0.97
IGL03244:Cyp4f18	APN	8	71988645	missense	probably benign	0.12
R0226:Cyp4f18	UTSW	8	71989775	splice site	probably benign
R0310:Cyp4f18	UTSW	8	72001012	splice site	probably benign
R0486:Cyp4f18	UTSW	8	71996017	missense	probably benign	0.02
R0506:Cyp4f18	UTSW	8	71996000	missense	probably benign	0.00
R0547:Cyp4f18	UTSW	8	71996010	missense	probably benign	0.00
R0689:Cyp4f18	UTSW	8	71995968	missense	probably benign
R0721:Cyp4f18	UTSW	8	72001135	missense	probably benign	0.02
R1534:Cyp4f18	UTSW	8	71992955	missense	probably damaging	1.00
R2087:Cyp4f18	UTSW	8	72000988	missense	probably benign
R2902:Cyp4f18	UTSW	8	72002411	missense	probably damaging	0.96
R3149:Cyp4f18	UTSW	8	71993200	missense	possibly damaging	0.69
R3150:Cyp4f18	UTSW	8	71993200	missense	possibly damaging	0.69
R3177:Cyp4f18	UTSW	8	71993200	missense	possibly damaging	0.69
R3277:Cyp4f18	UTSW	8	71993200	missense	possibly damaging	0.69
R3906:Cyp4f18	UTSW	8	72001082	splice site	probably benign
R3916:Cyp4f18	UTSW	8	71996037	missense	probably benign	0.03
R3953:Cyp4f18	UTSW	8	72000957	missense	probably damaging	1.00
R4815:Cyp4f18	UTSW	8	71995995	missense	possibly damaging	0.52
R4915:Cyp4f18	UTSW	8	72009054	missense	probably damaging	1.00
R5086:Cyp4f18	UTSW	8	72002432	missense	probably benign	0.00
R5113:Cyp4f18	UTSW	8	71989058	critical splice donor site	probably null
R5202:Cyp4f18	UTSW	8	72009096	missense	probably benign	0.03
R5761:Cyp4f18	UTSW	8	71996131	missense	probably damaging	0.99
R6187:Cyp4f18	UTSW	8	71993186	missense	probably damaging	0.98
R6664:Cyp4f18	UTSW	8	71989915	missense	probably benign	0.21
R6978:Cyp4f18	UTSW	8	72002496	missense	probably benign
R7288:Cyp4f18	UTSW	8	71993173	missense	probably damaging	1.00
R7326:Cyp4f18	UTSW	8	71988654	missense	probably benign	0.14
R7432:Cyp4f18	UTSW	8	71996062	missense	probably benign	0.00
R7871:Cyp4f18	UTSW	8	71988643	missense	possibly damaging	0.69
R8063:Cyp4f18	UTSW	8	71998231	missense	probably damaging	1.00
R8272:Cyp4f18	UTSW	8	71989091	missense	probably benign	0.44
R8321:Cyp4f18	UTSW	8	71988583	missense	possibly damaging	0.88
Z1177:Cyp4f18	UTSW	8	71998283	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TTAAGAGGGACAGCACCTCC -3'
(R):5'- CCATCTTAGCACTTAAAACAGGG -3'

Sequencing Primer
(F):5'- GTCTGGCCACACAGCTG -3'
(R):5'- GCATTAAGGAGAGCCTACG -3'

Posted On

2018-11-28