Incidental Mutation 'R6944:Samd4'
ID540801
Institutional Source Beutler Lab
Gene Symbol Samd4
Ensembl Gene ENSMUSG00000021838
Gene Namesterile alpha motif domain containing 4
Synonyms4933436G17Rik, 1700024G08Rik, Smaug, 1700111L17Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001037221, NM_028966, NM_001163433

Is this an essential gene? Probably essential (E-score: 0.864) question?
Stock #R6944 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location46882854-47105815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47016635 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 84 (D84E)
Ref Sequence ENSEMBL: ENSMUSP00000122833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022386] [ENSMUST00000100672] [ENSMUST00000125113] [ENSMUST00000137543] [ENSMUST00000228404]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022386
AA Change: D185E

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022386
Gene: ENSMUSG00000021838
AA Change: D185E

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
low complexity region 292 305 N/A INTRINSIC
SAM 320 383 1.4e-7 SMART
low complexity region 445 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100672
AA Change: D185E

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098237
Gene: ENSMUSG00000021838
AA Change: D185E

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
SAM 232 295 2.75e-6 SMART
low complexity region 357 375 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000125113
AA Change: D84E

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122833
Gene: ENSMUSG00000021838
AA Change: D84E

DomainStartEndE-ValueType
low complexity region 191 204 N/A INTRINSIC
SAM 219 282 1.4e-7 SMART
low complexity region 344 362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137543
AA Change: D185E

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114621
Gene: ENSMUSG00000021838
AA Change: D185E

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
SAM 232 295 2.75e-6 SMART
low complexity region 357 375 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000228404
AA Change: D84E

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sterile alpha motifs (SAMs) in proteins such as SAMD4A are part of an RNA-binding domain that functions as a posttranscriptional regulator by binding to an RNA sequence motif known as the Smaug recognition element, which was named after the Drosophila Smaug protein (Baez and Boccaccio, 2005 [PubMed 16221671]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit leaness, myopathy and altered glucose metabolism. Mice homozygous for a spontaneous mutation exhibit kyphosis, abnormal gait, and decreased cortical bone thickness. [provided by MGI curators]
Allele List at MGI

ll alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A C 10: 82,296,222 I318R probably benign Het
Abcb1b T G 5: 8,813,693 V216G probably damaging Het
Abcb5 T C 12: 118,911,530 R636G probably benign Het
Ago1 G T 4: 126,460,422 F198L possibly damaging Het
Ankrd42 C T 7: 92,619,547 probably null Het
Anxa11 T A 14: 25,874,752 F274I probably damaging Het
Ascc1 T C 10: 60,013,653 L122P probably damaging Het
Bptf T C 11: 107,080,823 S953G probably damaging Het
Chml T A 1: 175,688,161 N65Y probably damaging Het
Clcc1 A G 3: 108,670,968 K262E probably damaging Het
Clhc1 T G 11: 29,569,346 D384E probably damaging Het
Cnot2 G A 10: 116,537,223 probably benign Het
Cntnap1 T C 11: 101,182,904 V627A probably damaging Het
Col6a4 A G 9: 106,072,171 V755A probably damaging Het
Cyp4f18 T A 8: 71,989,894 I406F probably benign Het
Dclre1a T C 19: 56,545,019 E381G possibly damaging Het
Dnah1 A G 14: 31,268,904 Y3153H probably damaging Het
Dnah8 C A 17: 30,794,659 D3791E probably benign Het
Dnah9 T C 11: 66,085,149 E1358G possibly damaging Het
Eef1g G A 19: 8,968,292 R30H probably benign Het
Egln3 A T 12: 54,183,952 I181N probably benign Het
Entpd6 A G 2: 150,763,599 T250A probably damaging Het
Epb41l5 C T 1: 119,609,129 R344Q probably damaging Het
Fam20b T C 1: 156,687,521 D258G probably benign Het
Fbxw18 A T 9: 109,702,587 D21E probably damaging Het
Fbxw21 T C 9: 109,157,535 E92G probably damaging Het
Fzd6 T A 15: 39,025,817 M110K possibly damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gm9268 T C 7: 43,047,969 F817L possibly damaging Het
Golgb1 C T 16: 36,912,113 P574L probably benign Het
Gpr153 A G 4: 152,279,363 E80G probably damaging Het
Kcnt1 T C 2: 25,877,828 probably benign Het
Kcnt2 T G 1: 140,584,065 V962G probably benign Het
Malt1 T C 18: 65,437,920 V109A probably benign Het
March7 A G 2: 60,234,243 I288V probably benign Het
Mief1 C T 15: 80,249,443 R234C probably damaging Het
Morc3 A G 16: 93,870,572 S613G probably benign Het
Myt1 A G 2: 181,797,594 E345G possibly damaging Het
Napb T C 2: 148,706,969 T133A probably benign Het
Nwd1 T C 8: 72,653,534 V16A possibly damaging Het
Oas1f G A 5: 120,848,184 E67K probably benign Het
Obscn T C 11: 59,038,930 K5153R probably damaging Het
Olfr1441 G T 19: 12,423,264 M318I probably benign Het
Olfr154 C T 2: 85,663,851 M194I probably benign Het
Olfr212 T C 6: 116,515,830 F18L possibly damaging Het
Olfr317 T A 11: 58,732,242 S308C possibly damaging Het
Pdcd2 T C 17: 15,525,370 N185S possibly damaging Het
Pgap1 A T 1: 54,530,161 W349R probably damaging Het
Prpf39 T A 12: 65,042,680 V64E probably benign Het
Ptpn13 T A 5: 103,476,991 W54R probably null Het
Rbms3 G T 9: 117,110,105 P29Q probably damaging Het
Rnf123 A G 9: 108,063,623 L679P probably benign Het
Scarf1 T C 11: 75,522,206 V426A probably benign Het
Slc12a1 A G 2: 125,160,534 N145D probably damaging Het
Slc2a6 A T 2: 27,026,064 M99K probably damaging Het
Slc34a2 A T 5: 53,064,883 I306L probably benign Het
Slx4ip A G 2: 137,068,275 K397E probably damaging Het
Smr3a C T 5: 88,008,090 probably benign Het
Spef2 T C 15: 9,592,749 E1502G probably damaging Het
Sri A T 5: 8,063,365 T119S probably benign Het
Synrg T A 11: 84,025,086 L1085H probably damaging Het
Taf7 A T 18: 37,642,857 L219H probably damaging Het
Tmco3 T A 8: 13,303,729 V347E probably damaging Het
Tmem8b A T 4: 43,674,465 I250F probably damaging Het
Tom1l2 A G 11: 60,248,991 V239A probably damaging Het
Trpm1 T A 7: 64,243,433 M1011K probably damaging Het
Tspan9 A T 6: 127,965,806 Y153N probably benign Het
Ttll11 T C 2: 35,752,294 H675R probably benign Het
Unc50 C T 1: 37,432,662 T131M probably damaging Het
Vgf T A 5: 137,032,352 I456N probably damaging Het
Vmn1r223 A G 13: 23,249,313 I26V unknown Het
Vmn1r39 T C 6: 66,805,221 M1V probably null Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r14 T C 5: 109,216,059 T664A probably benign Het
Vmn2r14 G A 5: 109,216,274 T592I probably benign Het
Vmn2r96 T A 17: 18,597,629 F489L probably benign Het
Other mutations in Samd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Samd4 APN 14 47052898 missense probably damaging 1.00
IGL01413:Samd4 APN 14 47016792 missense probably benign 0.01
supermodel UTSW 14 47016337 missense probably damaging 1.00
B6584:Samd4 UTSW 14 47016337 missense probably damaging 1.00
G4846:Samd4 UTSW 14 47016319 missense probably damaging 1.00
R0096:Samd4 UTSW 14 47064297 missense possibly damaging 0.88
R0122:Samd4 UTSW 14 47016560 missense probably benign 0.44
R0562:Samd4 UTSW 14 47077509 missense probably damaging 1.00
R1247:Samd4 UTSW 14 47064328 critical splice donor site probably benign
R1247:Samd4 UTSW 14 47087758 small insertion probably benign
R1771:Samd4 UTSW 14 47089075 missense probably damaging 1.00
R1902:Samd4 UTSW 14 47074128 missense probably damaging 1.00
R1903:Samd4 UTSW 14 47074128 missense probably damaging 1.00
R2346:Samd4 UTSW 14 46884842 missense probably damaging 1.00
R4155:Samd4 UTSW 14 47052946 missense possibly damaging 0.74
R4498:Samd4 UTSW 14 47096109 missense probably damaging 1.00
R4510:Samd4 UTSW 14 47077585 missense probably benign 0.05
R4511:Samd4 UTSW 14 47077585 missense probably benign 0.05
R4658:Samd4 UTSW 14 47064246 missense probably damaging 1.00
R4871:Samd4 UTSW 14 47066463 missense probably damaging 1.00
R4991:Samd4 UTSW 14 47074010 missense probably damaging 0.97
R5432:Samd4 UTSW 14 47074062 missense probably benign 0.09
R5687:Samd4 UTSW 14 47016565 missense probably benign
R6035:Samd4 UTSW 14 47087872 missense probably damaging 1.00
R6035:Samd4 UTSW 14 47087872 missense probably damaging 1.00
R6254:Samd4 UTSW 14 47016631 missense probably damaging 1.00
R6366:Samd4 UTSW 14 47074150 critical splice donor site probably null
R6376:Samd4 UTSW 14 47052962 missense probably damaging 1.00
R7035:Samd4 UTSW 14 47089163 synonymous silent
R7148:Samd4 UTSW 14 47016683 missense probably benign 0.09
R7467:Samd4 UTSW 14 47087856 missense probably benign 0.19
R7999:Samd4 UTSW 14 47064247 missense probably damaging 0.99
R8301:Samd4 UTSW 14 47016678 missense probably benign
R8306:Samd4 UTSW 14 46884917 missense probably damaging 1.00
R8351:Samd4 UTSW 14 47101431 missense probably damaging 1.00
R8451:Samd4 UTSW 14 47101431 missense probably damaging 1.00
X0018:Samd4 UTSW 14 47016696 missense possibly damaging 0.94
X0022:Samd4 UTSW 14 47074017 missense probably benign 0.45
Z0001:Samd4 UTSW 14 47016337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGCACATTGAGGAGAGC -3'
(R):5'- CAAACCCGAATGCGTTCCAG -3'

Sequencing Primer
(F):5'- AGGCAGCTGCTGTCCTATG -3'
(R):5'- GAATGCGTTCCAGGGTCTC -3'
Posted On2018-11-28