Incidental Mutation 'R6944:Golgb1'
ID540805
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Namegolgi autoantigen, golgin subfamily b, macrogolgin 1
SynonymsGiantin, C130074L01Rik, F730017E11Rik, Gm6840, 6330407A06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_030035.1

Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R6944 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location36875140-36933085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36912113 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 574 (P574L)
Ref Sequence ENSEMBL: ENSMUSP00000110460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039855] [ENSMUST00000114812]
Predicted Effect probably benign
Transcript: ENSMUST00000039855
AA Change: P615L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045239
Gene: ENSMUSG00000034243
AA Change: P615L

DomainStartEndE-ValueType
internal_repeat_2 24 61 7.47e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
coiled coil region 130 219 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
internal_repeat_3 519 558 7.47e-6 PROSPERO
coiled coil region 563 594 N/A INTRINSIC
internal_repeat_4 627 661 3.38e-5 PROSPERO
coiled coil region 679 1121 N/A INTRINSIC
coiled coil region 1153 1240 N/A INTRINSIC
internal_repeat_4 1253 1288 3.38e-5 PROSPERO
low complexity region 1300 1314 N/A INTRINSIC
internal_repeat_1 1321 1352 3.51e-6 PROSPERO
low complexity region 1357 1369 N/A INTRINSIC
coiled coil region 1402 1755 N/A INTRINSIC
internal_repeat_2 1760 1798 7.47e-6 PROSPERO
internal_repeat_3 1761 1804 7.47e-6 PROSPERO
coiled coil region 1818 2034 N/A INTRINSIC
low complexity region 2291 2306 N/A INTRINSIC
internal_repeat_1 2351 2382 3.51e-6 PROSPERO
low complexity region 2400 2418 N/A INTRINSIC
low complexity region 2538 2549 N/A INTRINSIC
coiled coil region 2775 2827 N/A INTRINSIC
coiled coil region 2854 2943 N/A INTRINSIC
low complexity region 2964 2976 N/A INTRINSIC
coiled coil region 3007 3057 N/A INTRINSIC
coiled coil region 3117 3163 N/A INTRINSIC
transmembrane domain 3215 3237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114812
AA Change: P574L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243
AA Change: P574L

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 97% (75/77)
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A C 10: 82,296,222 I318R probably benign Het
Abcb1b T G 5: 8,813,693 V216G probably damaging Het
Abcb5 T C 12: 118,911,530 R636G probably benign Het
Ago1 G T 4: 126,460,422 F198L possibly damaging Het
Ankrd42 C T 7: 92,619,547 probably null Het
Anxa11 T A 14: 25,874,752 F274I probably damaging Het
Ascc1 T C 10: 60,013,653 L122P probably damaging Het
Bptf T C 11: 107,080,823 S953G probably damaging Het
Chml T A 1: 175,688,161 N65Y probably damaging Het
Clcc1 A G 3: 108,670,968 K262E probably damaging Het
Clhc1 T G 11: 29,569,346 D384E probably damaging Het
Cnot2 G A 10: 116,537,223 probably benign Het
Cntnap1 T C 11: 101,182,904 V627A probably damaging Het
Col6a4 A G 9: 106,072,171 V755A probably damaging Het
Cyp4f18 T A 8: 71,989,894 I406F probably benign Het
Dclre1a T C 19: 56,545,019 E381G possibly damaging Het
Dnah1 A G 14: 31,268,904 Y3153H probably damaging Het
Dnah8 C A 17: 30,794,659 D3791E probably benign Het
Dnah9 T C 11: 66,085,149 E1358G possibly damaging Het
Eef1g G A 19: 8,968,292 R30H probably benign Het
Egln3 A T 12: 54,183,952 I181N probably benign Het
Entpd6 A G 2: 150,763,599 T250A probably damaging Het
Epb41l5 C T 1: 119,609,129 R344Q probably damaging Het
Fam20b T C 1: 156,687,521 D258G probably benign Het
Fbxw18 A T 9: 109,702,587 D21E probably damaging Het
Fbxw21 T C 9: 109,157,535 E92G probably damaging Het
Fzd6 T A 15: 39,025,817 M110K possibly damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gm9268 T C 7: 43,047,969 F817L possibly damaging Het
Gpr153 A G 4: 152,279,363 E80G probably damaging Het
Kcnt1 T C 2: 25,877,828 probably benign Het
Kcnt2 T G 1: 140,584,065 V962G probably benign Het
Malt1 T C 18: 65,437,920 V109A probably benign Het
March7 A G 2: 60,234,243 I288V probably benign Het
Mief1 C T 15: 80,249,443 R234C probably damaging Het
Morc3 A G 16: 93,870,572 S613G probably benign Het
Myt1 A G 2: 181,797,594 E345G possibly damaging Het
Napb T C 2: 148,706,969 T133A probably benign Het
Nwd1 T C 8: 72,653,534 V16A possibly damaging Het
Oas1f G A 5: 120,848,184 E67K probably benign Het
Obscn T C 11: 59,038,930 K5153R probably damaging Het
Olfr1441 G T 19: 12,423,264 M318I probably benign Het
Olfr154 C T 2: 85,663,851 M194I probably benign Het
Olfr212 T C 6: 116,515,830 F18L possibly damaging Het
Olfr317 T A 11: 58,732,242 S308C possibly damaging Het
Pdcd2 T C 17: 15,525,370 N185S possibly damaging Het
Pgap1 A T 1: 54,530,161 W349R probably damaging Het
Prpf39 T A 12: 65,042,680 V64E probably benign Het
Ptpn13 T A 5: 103,476,991 W54R probably null Het
Rbms3 G T 9: 117,110,105 P29Q probably damaging Het
Rnf123 A G 9: 108,063,623 L679P probably benign Het
Samd4 T A 14: 47,016,635 D84E possibly damaging Het
Scarf1 T C 11: 75,522,206 V426A probably benign Het
Slc12a1 A G 2: 125,160,534 N145D probably damaging Het
Slc2a6 A T 2: 27,026,064 M99K probably damaging Het
Slc34a2 A T 5: 53,064,883 I306L probably benign Het
Slx4ip A G 2: 137,068,275 K397E probably damaging Het
Smr3a C T 5: 88,008,090 probably benign Het
Spef2 T C 15: 9,592,749 E1502G probably damaging Het
Sri A T 5: 8,063,365 T119S probably benign Het
Synrg T A 11: 84,025,086 L1085H probably damaging Het
Taf7 A T 18: 37,642,857 L219H probably damaging Het
Tmco3 T A 8: 13,303,729 V347E probably damaging Het
Tmem8b A T 4: 43,674,465 I250F probably damaging Het
Tom1l2 A G 11: 60,248,991 V239A probably damaging Het
Trpm1 T A 7: 64,243,433 M1011K probably damaging Het
Tspan9 A T 6: 127,965,806 Y153N probably benign Het
Ttll11 T C 2: 35,752,294 H675R probably benign Het
Unc50 C T 1: 37,432,662 T131M probably damaging Het
Vgf T A 5: 137,032,352 I456N probably damaging Het
Vmn1r223 A G 13: 23,249,313 I26V unknown Het
Vmn1r39 T C 6: 66,805,221 M1V probably null Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r14 T C 5: 109,216,059 T664A probably benign Het
Vmn2r14 G A 5: 109,216,274 T592I probably benign Het
Vmn2r96 T A 17: 18,597,629 F489L probably benign Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36931564 missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36915502 nonsense probably null
IGL01965:Golgb1 APN 16 36917920 missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36916304 missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36913128 missense probably benign 0.25
IGL02383:Golgb1 APN 16 36886200 missense probably benign 0.01
IGL02444:Golgb1 APN 16 36907816 splice site probably benign
IGL02635:Golgb1 APN 16 36915013 missense probably benign 0.00
IGL02655:Golgb1 APN 16 36918080 missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36925849 missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36916210 missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36912080 missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36925810 missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36912866 missense probably benign 0.11
IGL03109:Golgb1 APN 16 36915611 missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36913453 nonsense probably null
I2288:Golgb1 UTSW 16 36898542 missense probably benign 0.00
I2289:Golgb1 UTSW 16 36898542 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0080:Golgb1 UTSW 16 36898611 missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36875468 intron probably benign
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0276:Golgb1 UTSW 16 36913876 missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36875579 intron probably benign
R0469:Golgb1 UTSW 16 36931635 missense probably benign 0.41
R0522:Golgb1 UTSW 16 36915205 frame shift probably null
R0575:Golgb1 UTSW 16 36918809 missense probably benign
R0600:Golgb1 UTSW 16 36916271 missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36916330 nonsense probably null
R0711:Golgb1 UTSW 16 36918790 missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36898790 missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36912277 missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36916126 missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36915205 frame shift probably null
R1315:Golgb1 UTSW 16 36914900 missense probably benign 0.40
R1429:Golgb1 UTSW 16 36900563 missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36919643 missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36898788 missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36926101 missense probably benign 0.25
R1659:Golgb1 UTSW 16 36887617 missense probably benign 0.01
R1769:Golgb1 UTSW 16 36916001 missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36914664 missense probably benign
R2212:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36893360 missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36898559 missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36912008 missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36918466 missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36915151 missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36894849 missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36918912 missense probably benign 0.00
R3847:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3850:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3936:Golgb1 UTSW 16 36914056 nonsense probably null
R3975:Golgb1 UTSW 16 36918571 missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36915344 missense probably benign 0.00
R4369:Golgb1 UTSW 16 36916907 missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36929263 missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36887618 missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36891419 missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36913115 missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36891407 missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36893386 missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36916118 missense probably benign 0.05
R5121:Golgb1 UTSW 16 36919258 missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36891457 missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36898689 missense probably benign 0.09
R5185:Golgb1 UTSW 16 36875141 unclassified probably benign
R5188:Golgb1 UTSW 16 36918465 missense probably benign 0.13
R5260:Golgb1 UTSW 16 36913141 missense probably benign 0.00
R5297:Golgb1 UTSW 16 36875616 intron probably benign
R5386:Golgb1 UTSW 16 36912315 nonsense probably null
R5438:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5439:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5494:Golgb1 UTSW 16 36928683 missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36925763 missense probably benign 0.02
R5740:Golgb1 UTSW 16 36919000 missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36926091 splice site silent
R5928:Golgb1 UTSW 16 36911987 missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36914959 missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36914671 missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36912865 missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36893395 missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36915622 missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36913978 missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36918197 nonsense probably null
R6700:Golgb1 UTSW 16 36875584 intron probably benign
R6870:Golgb1 UTSW 16 36918203 missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36913990 missense probably benign
R7108:Golgb1 UTSW 16 36913721 missense probably benign 0.01
R7124:Golgb1 UTSW 16 36913673 missense probably benign 0.01
R7125:Golgb1 UTSW 16 36917963 missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36916150 missense probably benign 0.43
R7205:Golgb1 UTSW 16 36875301 missense unknown
R7206:Golgb1 UTSW 16 36913749 missense probably benign 0.41
R7233:Golgb1 UTSW 16 36914758 missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36915951 nonsense probably null
R7367:Golgb1 UTSW 16 36898546 missense probably benign 0.00
R7408:Golgb1 UTSW 16 36898547 missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36912919 missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36915793 missense probably benign 0.03
R7599:Golgb1 UTSW 16 36875396 missense unknown
R7673:Golgb1 UTSW 16 36913669 missense probably benign 0.05
R7789:Golgb1 UTSW 16 36875399 missense unknown
R7792:Golgb1 UTSW 16 36918730 missense probably benign 0.43
R7830:Golgb1 UTSW 16 36898721 missense possibly damaging 0.93
R7847:Golgb1 UTSW 16 36931920 missense probably damaging 1.00
R7905:Golgb1 UTSW 16 36913685 missense probably benign
R7944:Golgb1 UTSW 16 36914104 missense probably benign 0.02
R7945:Golgb1 UTSW 16 36914104 missense probably benign 0.02
R7950:Golgb1 UTSW 16 36915424 missense probably benign 0.13
R8040:Golgb1 UTSW 16 36913479 missense possibly damaging 0.85
R8077:Golgb1 UTSW 16 36918633 missense probably damaging 0.99
R8181:Golgb1 UTSW 16 36916830 missense probably damaging 1.00
R8370:Golgb1 UTSW 16 36912317 missense probably benign 0.00
V1662:Golgb1 UTSW 16 36898542 missense probably benign 0.00
X0067:Golgb1 UTSW 16 36914303 nonsense probably null
Z1088:Golgb1 UTSW 16 36919742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACAGGAGTGACTCTTCTCCTG -3'
(R):5'- ACTGCGAGGGATTTGTCCAC -3'

Sequencing Primer
(F):5'- TTCTCCTGAAGAAAATGGGCAG -3'
(R):5'- AGGGATTTGTCCACGCCATC -3'
Posted On2018-11-28