Incidental Mutation 'R6944:Vmn2r96'
ID 540808
Institutional Source Beutler Lab
Gene Symbol Vmn2r96
Ensembl Gene ENSMUSG00000091679
Gene Name vomeronasal 2, receptor 96
Synonyms EG433070
MMRRC Submission 045058-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.157) question?
Stock # R6944 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 18793282-18818419 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18817891 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 489 (F489L)
Ref Sequence ENSEMBL: ENSMUSP00000131564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165692] [ENSMUST00000177244] [ENSMUST00000231261] [ENSMUST00000231286]
AlphaFold E9PZU5
Predicted Effect probably benign
Transcript: ENSMUST00000165692
AA Change: F489L

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131564
Gene: ENSMUSG00000091679
AA Change: F489L

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 257 8.6e-20 PFAM
Pfam:NCD3G 317 370 3.7e-22 PFAM
Pfam:7tm_3 402 638 3.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177244
AA Change: F681L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135095
Gene: ENSMUSG00000091679
AA Change: F681L

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 245 4.2e-19 PFAM
Pfam:NCD3G 317 370 6.9e-21 PFAM
Pfam:7tm_3 400 639 3.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231261
Predicted Effect probably benign
Transcript: ENSMUST00000231286
AA Change: F681L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 97% (75/77)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T G 5: 8,863,693 (GRCm39) V216G probably damaging Het
Abcb5 T C 12: 118,875,265 (GRCm39) R636G probably benign Het
Ago1 G T 4: 126,354,215 (GRCm39) F198L possibly damaging Het
Ankrd42 C T 7: 92,268,755 (GRCm39) probably null Het
Anxa11 T A 14: 25,875,176 (GRCm39) F274I probably damaging Het
Ascc1 T C 10: 59,849,475 (GRCm39) L122P probably damaging Het
Bptf T C 11: 106,971,649 (GRCm39) S953G probably damaging Het
Chml T A 1: 175,515,727 (GRCm39) N65Y probably damaging Het
Clcc1 A G 3: 108,578,284 (GRCm39) K262E probably damaging Het
Clhc1 T G 11: 29,519,346 (GRCm39) D384E probably damaging Het
Cnot2 G A 10: 116,373,128 (GRCm39) probably benign Het
Cntnap1 T C 11: 101,073,730 (GRCm39) V627A probably damaging Het
Col6a4 A G 9: 105,949,370 (GRCm39) V755A probably damaging Het
Cyp4f18 T A 8: 72,743,738 (GRCm39) I406F probably benign Het
Dclre1a T C 19: 56,533,451 (GRCm39) E381G possibly damaging Het
Dnah1 A G 14: 30,990,861 (GRCm39) Y3153H probably damaging Het
Dnah8 C A 17: 31,013,633 (GRCm39) D3791E probably benign Het
Dnah9 T C 11: 65,975,975 (GRCm39) E1358G possibly damaging Het
Eef1g G A 19: 8,945,656 (GRCm39) R30H probably benign Het
Egln3 A T 12: 54,230,738 (GRCm39) I181N probably benign Het
Entpd6 A G 2: 150,605,519 (GRCm39) T250A probably damaging Het
Epb41l5 C T 1: 119,536,859 (GRCm39) R344Q probably damaging Het
Fam20b T C 1: 156,515,091 (GRCm39) D258G probably benign Het
Fbxw18 A T 9: 109,531,655 (GRCm39) D21E probably damaging Het
Fbxw21 T C 9: 108,986,603 (GRCm39) E92G probably damaging Het
Fzd6 T A 15: 38,889,212 (GRCm39) M110K possibly damaging Het
Golgb1 C T 16: 36,732,475 (GRCm39) P574L probably benign Het
Gpr153 A G 4: 152,363,820 (GRCm39) E80G probably damaging Het
Gvin2 G A 7: 105,551,187 (GRCm39) Q622* probably null Het
Kcnt1 T C 2: 25,767,840 (GRCm39) probably benign Het
Kcnt2 T G 1: 140,511,803 (GRCm39) V962G probably benign Het
Malt1 T C 18: 65,570,991 (GRCm39) V109A probably benign Het
Marchf7 A G 2: 60,064,587 (GRCm39) I288V probably benign Het
Mief1 C T 15: 80,133,644 (GRCm39) R234C probably damaging Het
Morc3 A G 16: 93,667,460 (GRCm39) S613G probably benign Het
Myt1 A G 2: 181,439,387 (GRCm39) E345G possibly damaging Het
Napb T C 2: 148,548,889 (GRCm39) T133A probably benign Het
Nwd1 T C 8: 73,380,162 (GRCm39) V16A possibly damaging Het
Oas1f G A 5: 120,986,247 (GRCm39) E67K probably benign Het
Obscn T C 11: 58,929,756 (GRCm39) K5153R probably damaging Het
Or2w3b T A 11: 58,623,068 (GRCm39) S308C possibly damaging Het
Or5a3 G T 19: 12,400,628 (GRCm39) M318I probably benign Het
Or5g26 C T 2: 85,494,195 (GRCm39) M194I probably benign Het
Or6d12 T C 6: 116,492,791 (GRCm39) F18L possibly damaging Het
Pdcd2 T C 17: 15,745,632 (GRCm39) N185S possibly damaging Het
Pgap1 A T 1: 54,569,320 (GRCm39) W349R probably damaging Het
Prpf39 T A 12: 65,089,454 (GRCm39) V64E probably benign Het
Ptpn13 T A 5: 103,624,857 (GRCm39) W54R probably null Het
Rbms3 G T 9: 116,939,173 (GRCm39) P29Q probably damaging Het
Rnf123 A G 9: 107,940,822 (GRCm39) L679P probably benign Het
Samd4 T A 14: 47,254,092 (GRCm39) D84E possibly damaging Het
Scarf1 T C 11: 75,413,032 (GRCm39) V426A probably benign Het
Slc12a1 A G 2: 125,002,454 (GRCm39) N145D probably damaging Het
Slc2a6 A T 2: 26,916,076 (GRCm39) M99K probably damaging Het
Slc34a2 A T 5: 53,222,225 (GRCm39) I306L probably benign Het
Slx4ip A G 2: 136,910,195 (GRCm39) K397E probably damaging Het
Smr3a C T 5: 88,155,949 (GRCm39) probably benign Het
Spata31h1 A C 10: 82,132,056 (GRCm39) I318R probably benign Het
Spef2 T C 15: 9,592,835 (GRCm39) E1502G probably damaging Het
Sri A T 5: 8,113,365 (GRCm39) T119S probably benign Het
Synrg T A 11: 83,915,912 (GRCm39) L1085H probably damaging Het
Taf7 A T 18: 37,775,910 (GRCm39) L219H probably damaging Het
Tmco3 T A 8: 13,353,729 (GRCm39) V347E probably damaging Het
Tmem8b A T 4: 43,674,465 (GRCm39) I250F probably damaging Het
Tom1l2 A G 11: 60,139,817 (GRCm39) V239A probably damaging Het
Trpm1 T A 7: 63,893,181 (GRCm39) M1011K probably damaging Het
Tspan9 A T 6: 127,942,769 (GRCm39) Y153N probably benign Het
Ttll11 T C 2: 35,642,306 (GRCm39) H675R probably benign Het
Unc50 C T 1: 37,471,743 (GRCm39) T131M probably damaging Het
Vgf T A 5: 137,061,206 (GRCm39) I456N probably damaging Het
Vmn1r223 A G 13: 23,433,483 (GRCm39) I26V unknown Het
Vmn1r39 T C 6: 66,782,205 (GRCm39) M1V probably null Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vmn2r14 T C 5: 109,363,925 (GRCm39) T664A probably benign Het
Vmn2r14 G A 5: 109,364,140 (GRCm39) T592I probably benign Het
Vmn2r-ps158 T C 7: 42,697,393 (GRCm39) F817L possibly damaging Het
Other mutations in Vmn2r96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Vmn2r96 APN 17 18,804,077 (GRCm39) missense probably benign 0.00
IGL00563:Vmn2r96 APN 17 18,804,077 (GRCm39) missense probably benign 0.00
IGL00769:Vmn2r96 APN 17 18,804,081 (GRCm39) missense probably benign 0.00
IGL01314:Vmn2r96 APN 17 18,803,226 (GRCm39) missense probably benign 0.00
IGL01983:Vmn2r96 APN 17 18,817,527 (GRCm39) missense probably damaging 0.99
IGL02314:Vmn2r96 APN 17 18,804,221 (GRCm39) missense probably benign 0.01
IGL02600:Vmn2r96 APN 17 18,817,829 (GRCm39) missense probably benign
IGL02672:Vmn2r96 APN 17 18,818,376 (GRCm39) missense probably benign 0.02
IGL02750:Vmn2r96 APN 17 18,802,851 (GRCm39) missense probably benign 0.01
IGL03068:Vmn2r96 APN 17 18,803,137 (GRCm39) missense probably benign 0.00
IGL03411:Vmn2r96 APN 17 18,806,634 (GRCm39) missense possibly damaging 0.88
R0316:Vmn2r96 UTSW 17 18,802,827 (GRCm39) missense probably damaging 1.00
R0502:Vmn2r96 UTSW 17 18,804,262 (GRCm39) missense probably benign
R0580:Vmn2r96 UTSW 17 18,802,900 (GRCm39) missense probably damaging 1.00
R0652:Vmn2r96 UTSW 17 18,817,830 (GRCm39) missense probably benign 0.05
R0789:Vmn2r96 UTSW 17 18,802,738 (GRCm39) missense possibly damaging 0.81
R1462:Vmn2r96 UTSW 17 18,817,660 (GRCm39) missense possibly damaging 0.94
R1462:Vmn2r96 UTSW 17 18,817,660 (GRCm39) missense possibly damaging 0.94
R1660:Vmn2r96 UTSW 17 18,817,988 (GRCm39) missense probably benign 0.00
R1755:Vmn2r96 UTSW 17 18,802,915 (GRCm39) missense possibly damaging 0.50
R1843:Vmn2r96 UTSW 17 18,818,183 (GRCm39) missense probably benign 0.14
R1943:Vmn2r96 UTSW 17 18,806,664 (GRCm39) missense probably benign 0.09
R1993:Vmn2r96 UTSW 17 18,804,138 (GRCm39) missense probably damaging 1.00
R2018:Vmn2r96 UTSW 17 18,804,263 (GRCm39) missense probably benign
R2405:Vmn2r96 UTSW 17 18,818,102 (GRCm39) missense probably damaging 0.96
R3977:Vmn2r96 UTSW 17 18,817,941 (GRCm39) missense probably damaging 1.00
R3979:Vmn2r96 UTSW 17 18,817,941 (GRCm39) missense probably damaging 1.00
R4059:Vmn2r96 UTSW 17 18,818,339 (GRCm39) missense probably benign 0.20
R4693:Vmn2r96 UTSW 17 18,803,270 (GRCm39) missense probably benign 0.03
R4709:Vmn2r96 UTSW 17 18,803,088 (GRCm39) missense probably benign 0.36
R4776:Vmn2r96 UTSW 17 18,817,770 (GRCm39) missense probably damaging 1.00
R4882:Vmn2r96 UTSW 17 18,817,866 (GRCm39) missense probably damaging 1.00
R4920:Vmn2r96 UTSW 17 18,802,918 (GRCm39) missense probably benign 0.07
R5143:Vmn2r96 UTSW 17 18,804,120 (GRCm39) missense possibly damaging 0.65
R5301:Vmn2r96 UTSW 17 18,817,950 (GRCm39) missense probably damaging 0.98
R5507:Vmn2r96 UTSW 17 18,818,091 (GRCm39) missense probably damaging 1.00
R6151:Vmn2r96 UTSW 17 18,804,221 (GRCm39) missense probably benign 0.01
R6181:Vmn2r96 UTSW 17 18,804,126 (GRCm39) missense probably benign
R6339:Vmn2r96 UTSW 17 18,804,124 (GRCm39) missense possibly damaging 0.84
R6404:Vmn2r96 UTSW 17 18,817,793 (GRCm39) missense probably damaging 1.00
R6452:Vmn2r96 UTSW 17 18,804,117 (GRCm39) missense probably benign 0.07
R6749:Vmn2r96 UTSW 17 18,818,352 (GRCm39) missense probably damaging 0.99
R6813:Vmn2r96 UTSW 17 18,802,116 (GRCm39) missense probably benign 0.04
R6851:Vmn2r96 UTSW 17 18,802,800 (GRCm39) missense possibly damaging 0.95
R6949:Vmn2r96 UTSW 17 18,818,100 (GRCm39) missense probably damaging 1.00
R6962:Vmn2r96 UTSW 17 18,818,283 (GRCm39) missense probably damaging 0.99
R6990:Vmn2r96 UTSW 17 18,804,082 (GRCm39) missense probably benign
R7149:Vmn2r96 UTSW 17 18,817,989 (GRCm39) missense possibly damaging 0.89
R7346:Vmn2r96 UTSW 17 18,803,029 (GRCm39) missense probably benign 0.15
R7385:Vmn2r96 UTSW 17 18,803,302 (GRCm39) missense probably damaging 1.00
R7442:Vmn2r96 UTSW 17 18,793,662 (GRCm39) missense probably benign 0.02
R7509:Vmn2r96 UTSW 17 18,802,995 (GRCm39) missense probably benign 0.02
R7652:Vmn2r96 UTSW 17 18,793,832 (GRCm39) missense probably benign
R7659:Vmn2r96 UTSW 17 18,793,749 (GRCm39) missense probably benign 0.00
R7753:Vmn2r96 UTSW 17 18,806,663 (GRCm39) missense possibly damaging 0.46
R7855:Vmn2r96 UTSW 17 18,818,130 (GRCm39) missense possibly damaging 0.59
R8166:Vmn2r96 UTSW 17 18,802,744 (GRCm39) missense probably damaging 1.00
R8260:Vmn2r96 UTSW 17 18,804,243 (GRCm39) missense probably benign 0.04
R8323:Vmn2r96 UTSW 17 18,803,023 (GRCm39) missense probably damaging 0.99
R8787:Vmn2r96 UTSW 17 18,818,250 (GRCm39) missense probably damaging 1.00
R8837:Vmn2r96 UTSW 17 18,802,888 (GRCm39) missense probably benign
R8933:Vmn2r96 UTSW 17 18,804,241 (GRCm39) missense probably benign 0.11
R9306:Vmn2r96 UTSW 17 18,803,226 (GRCm39) missense probably benign 0.00
R9481:Vmn2r96 UTSW 17 18,793,621 (GRCm39) start gained probably benign
R9626:Vmn2r96 UTSW 17 18,793,758 (GRCm39) missense probably benign 0.14
R9629:Vmn2r96 UTSW 17 18,803,257 (GRCm39) missense probably benign 0.15
Z1088:Vmn2r96 UTSW 17 18,817,628 (GRCm39) missense possibly damaging 0.86
Z1177:Vmn2r96 UTSW 17 18,818,376 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAGACACTCCTATTGTCAAGGC -3'
(R):5'- ACAGATGAGCCCTTGTTGCAC -3'

Sequencing Primer
(F):5'- GGCAAATAATCGAGCTCTGAGTTAC -3'
(R):5'- GAGCCCTTGTTGCACAAAATG -3'
Posted On 2018-11-28