Mutagenetix > Incidental Mutation

Incidental Mutation 'R6945:Sf3b1'

540818

Institutional Source

Beutler Lab

Gene Symbol

Sf3b1

Ensembl Gene

ENSMUSG00000025982

Gene Name

splicing factor 3b, subunit 1

Synonyms

Targ4, SAP155, Prp10, 2810001M05Rik, SF3b155

MMRRC Submission

045059-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6945 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

54985169-55027481 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 54997156 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 919 (N919K)

Ref Sequence

ENSEMBL: ENSMUSP00000027127 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027127]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000027127
AA Change: N919K

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000027127
Gene: ENSMUSG00000025982
AA Change: N919K

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	65	75	N/A	INTRINSIC
internal_repeat_1	185	276	1.77e-12	PROSPERO
Pfam:SF3b1	329	452	1.2e-51	PFAM
SCOP:d1qbkb_	489	1289	5e-62	SMART
Blast:ARM	593	637	6e-13	BLAST
Blast:ARM	1005	1044	7e-14	BLAST

Meta Mutation Damage Score

0.0775

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

96% (51/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die around the 16- to 32-cell stage. Heterozygous mice exhibit various skeletal transformations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	A	C	5: 109,676,845	N246K	probably benign	Het
AA792892	C	T	5: 94,383,631	H125Y	possibly damaging	Het
Abcc5	T	A	16: 20,400,009	T208S	probably benign	Het
Acaa2	A	G	18: 74,793,309	E112G	probably benign	Het
Adgrb1	A	G	15: 74,550,024	N881S	probably damaging	Het
Adgre1	A	G	17: 57,410,844	E314G	probably benign	Het
Adgre1	A	G	17: 57,420,399	E443G	probably benign	Het
Akp3	A	G	1: 87,125,631	Y102C	probably damaging	Het
Birc6	A	G	17: 74,579,531	N618S	probably benign	Het
Bpifc	A	G	10: 85,979,214	V296A	probably benign	Het
Cacna2d3	G	A	14: 28,969,318		probably benign	Het
Cacnb4	T	C	2: 52,474,954	N99S	probably damaging	Het
Cd38	A	G	5: 43,908,006	Y283C	probably damaging	Het
Celf4	T	A	18: 25,496,236	Q411L	probably damaging	Het
Cemip	A	T	7: 83,998,547	H108Q	probably damaging	Het
Col23a1	A	G	11: 51,561,893	E225G	unknown	Het
Dnah11	T	C	12: 118,060,310	E1902G	probably damaging	Het
Dst	A	G	1: 34,190,490	D2063G	probably damaging	Het
Fsip2	A	T	2: 82,992,840	I6306L	probably benign	Het
Furin	A	G	7: 80,391,090	S667P	possibly damaging	Het
Glmp	T	A	3: 88,325,832	S92R	probably benign	Het
Gm11563	C	G	11: 99,658,472	C152S	unknown	Het
Gm3486	A	G	14: 41,484,561	V185A	probably benign	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Hyal1	C	A	9: 107,579,170	A102E	probably damaging	Het
Invs	T	C	4: 48,421,785	C806R	probably benign	Het
L1td1	T	C	4: 98,733,696	V165A	probably benign	Het
Lama1	A	G	17: 67,813,866	T2666A		Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Lrrc8a	A	G	2: 30,256,227	Y351C	probably damaging	Het
Myh7b	T	C	2: 155,622,232	F551S	possibly damaging	Het
Myo19	A	G	11: 84,897,560	T333A	probably benign	Het
Nrp2	A	T	1: 62,760,788	N387I	probably damaging	Het
Oas2	T	C	5: 120,736,139	D543G	probably benign	Het
Olfr1040	A	G	2: 86,146,084	S217P	probably damaging	Het
Olfr117	A	G	17: 37,659,514	I273T	possibly damaging	Het
Pak7	A	G	2: 136,100,939	V427A	probably benign	Het
Pfas	G	A	11: 69,000,530	A247V	probably benign	Het
Psat1	T	A	19: 15,917,181	T115S	probably benign	Het
Psme4	T	A	11: 30,837,437	D1077E	probably benign	Het
Rabgap1l	A	G	1: 160,682,182	S442P	probably benign	Het
Ralgapa1	A	G	12: 55,776,191	M280T	possibly damaging	Het
Rb1cc1	A	T	1: 6,261,032	E394D	probably damaging	Het
Seh1l	T	C	18: 67,789,390	V271A	probably benign	Het
Sftpd	A	G	14: 41,174,492	S245P	possibly damaging	Het
Slc22a15	T	C	3: 101,924,114	E2G	probably damaging	Het
Spta1	A	G	1: 174,209,325	D1134G	possibly damaging	Het
Syna	A	G	5: 134,558,961	V378A	probably damaging	Het
Tchp	A	G	5: 114,709,350	K77E	possibly damaging	Het
Tescl	T	C	7: 24,333,531	N123S	probably benign	Het
Trio	C	T	15: 27,824,090	R1443Q	probably damaging	Het
Trrap	A	T	5: 144,790,855	Y462F	possibly damaging	Het
Vmn1r78	A	G	7: 12,152,905	T148A	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het

Other mutations in Sf3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Sf3b1	APN	1	54987486	missense	probably damaging	1.00
IGL00815:Sf3b1	APN	1	54996931	splice site	probably benign
IGL01380:Sf3b1	APN	1	54987949	missense	probably damaging	1.00
IGL01390:Sf3b1	APN	1	54987429	missense	probably benign	0.17
IGL02974:Sf3b1	APN	1	55007707	missense	probably benign	0.00
IGL03159:Sf3b1	APN	1	55012213	missense	probably benign
Colt	UTSW	1	54997156	missense	probably benign	0.45
Glock	UTSW	1	55001046	missense	probably damaging	0.96
Handgun	UTSW	1	55007507	missense	probably damaging	1.00
Kalashnikov	UTSW	1	55019265	missense	probably damaging	0.99
Magazine	UTSW	1	55012182	nonsense	probably null
Revolver	UTSW	1	55019389	nonsense	probably null
R0053:Sf3b1	UTSW	1	55000373	nonsense	probably null
R0053:Sf3b1	UTSW	1	55000373	nonsense	probably null
R0190:Sf3b1	UTSW	1	54990306	missense	probably damaging	0.99
R0277:Sf3b1	UTSW	1	55019257	missense	probably damaging	0.99
R0323:Sf3b1	UTSW	1	55019257	missense	probably damaging	0.99
R0369:Sf3b1	UTSW	1	54998108	missense	probably benign	0.10
R0396:Sf3b1	UTSW	1	55019271	missense	probably damaging	1.00
R0718:Sf3b1	UTSW	1	55019385	missense	probably damaging	0.99
R0991:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1082:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1083:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1084:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1196:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1376:Sf3b1	UTSW	1	55019265	missense	probably damaging	0.99
R1376:Sf3b1	UTSW	1	55019265	missense	probably damaging	0.99
R1381:Sf3b1	UTSW	1	55003154	missense	probably damaging	0.99
R1436:Sf3b1	UTSW	1	55001421	missense	possibly damaging	0.72
R1559:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1560:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1561:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1567:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1568:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1588:Sf3b1	UTSW	1	54997177	missense	probably benign	0.05
R1625:Sf3b1	UTSW	1	55019377	missense	probably damaging	1.00
R1694:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1735:Sf3b1	UTSW	1	55000652	missense	probably damaging	1.00
R1900:Sf3b1	UTSW	1	54998188	missense	possibly damaging	0.75
R2186:Sf3b1	UTSW	1	55007633	missense	probably benign
R2429:Sf3b1	UTSW	1	55016801	missense	possibly damaging	0.71
R2473:Sf3b1	UTSW	1	54999626	critical splice donor site	probably null
R3772:Sf3b1	UTSW	1	54999991	intron	probably benign
R3911:Sf3b1	UTSW	1	55019389	nonsense	probably null
R3970:Sf3b1	UTSW	1	55012182	nonsense	probably null
R4706:Sf3b1	UTSW	1	54990507	missense	probably damaging	1.00
R4707:Sf3b1	UTSW	1	54990507	missense	probably damaging	1.00
R4964:Sf3b1	UTSW	1	54999712	missense	probably benign
R5053:Sf3b1	UTSW	1	54997177	missense	probably benign	0.05
R5358:Sf3b1	UTSW	1	55003310	missense	probably benign	0.09
R5379:Sf3b1	UTSW	1	55003150	missense	possibly damaging	0.94
R5628:Sf3b1	UTSW	1	54998175	missense	probably benign	0.27
R5636:Sf3b1	UTSW	1	54997193	missense	probably damaging	1.00
R6013:Sf3b1	UTSW	1	55000298	missense	probably damaging	0.98
R6149:Sf3b1	UTSW	1	55007507	missense	probably damaging	1.00
R6217:Sf3b1	UTSW	1	55007518	missense	probably damaging	1.00
R6426:Sf3b1	UTSW	1	54999655	missense	probably benign	0.01
R6531:Sf3b1	UTSW	1	55019395	missense	probably damaging	0.99
R7001:Sf3b1	UTSW	1	55001046	missense	probably damaging	0.96
R7001:Sf3b1	UTSW	1	55014481	critical splice donor site	probably null
R7302:Sf3b1	UTSW	1	55016790	missense	probably benign	0.00
R7644:Sf3b1	UTSW	1	54997143	nonsense	probably null
R7664:Sf3b1	UTSW	1	54987467	missense	probably damaging	1.00
R7735:Sf3b1	UTSW	1	55003349	missense	probably benign	0.29
R7809:Sf3b1	UTSW	1	54995455	missense	possibly damaging	0.60
R8516:Sf3b1	UTSW	1	55012103	missense	probably null	0.01
R8871:Sf3b1	UTSW	1	54990349	missense	probably damaging	1.00
R8947:Sf3b1	UTSW	1	55000285	missense	probably damaging	1.00
R9216:Sf3b1	UTSW	1	55012217	missense	probably benign	0.00
Z1177:Sf3b1	UTSW	1	55003402	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCTGCCCAATACTTCAGGG -3'
(R):5'- TGACCAGTTGTCCTCAGTTTAAC -3'

Sequencing Primer
(F):5'- GCCCAATACTTCAGGGTACTC -3'
(R):5'- ACAAATGGGATGTTTGGG -3'

Posted On

2018-11-28