Mutagenetix > Incidental Mutations

Incidental Mutation 'R6945:Nrp2'

540819

Institutional Source

Beutler Lab

Gene Symbol

Nrp2

Ensembl Gene

ENSMUSG00000025969

Gene Name

neuropilin 2

Synonyms

Npn2, NP-2, NP2, Npn-2, 1110048P06Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R6945 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62703285-62818695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62760788 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 387 (N387I)

Ref Sequence

ENSEMBL: ENSMUSP00000109794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027112] [ENSMUST00000063594] [ENSMUST00000075144] [ENSMUST00000102822] [ENSMUST00000114155] [ENSMUST00000114157]

AlphaFold

O35375

Predicted Effect

probably damaging
Transcript: ENSMUST00000027112
AA Change: N387I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027112
Gene: ENSMUSG00000025969
AA Change: N387I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
Pfam:DUF3481	822	906	1.4e-35	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000063594
AA Change: N387I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000069379
Gene: ENSMUSG00000025969
AA Change: N387I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
low complexity region	816	831	N/A	INTRINSIC
Pfam:DUF3481	839	923	1.6e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000075144
AA Change: N387I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074642
Gene: ENSMUSG00000025969
AA Change: N387I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
Pfam:DUF3481	827	911	2.3e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102822
AA Change: N387I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099886
Gene: ENSMUSG00000025969
AA Change: N387I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
Pfam:DUF3481	822	906	2.3e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114155
AA Change: N387I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109792
Gene: ENSMUSG00000025969
AA Change: N387I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
Pfam:DUF3481	817	901	9.4e-36	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114157
AA Change: N387I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109794
Gene: ENSMUSG00000025969
AA Change: N387I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
low complexity region	821	836	N/A	INTRINSIC
Pfam:DUF3481	844	928	2.4e-25	PFAM

Meta Mutation Damage Score

0.9743

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

96% (51/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice may exhibit pre- or postnatal lethality, reduced fertility, hydrocephalus, aberrant sensory innervation, reduced interneuron count, seizure susceptibility and abnormal lymphangiogenesis. Homozygotes for a gene trap allele show abnormal neuronal development and axonal trajectories. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	A	C	5: 109,676,845	N246K	probably benign	Het
AA792892	C	T	5: 94,383,631	H125Y	possibly damaging	Het
Abcc5	T	A	16: 20,400,009	T208S	probably benign	Het
Acaa2	A	G	18: 74,793,309	E112G	probably benign	Het
Adgrb1	A	G	15: 74,550,024	N881S	probably damaging	Het
Adgre1	A	G	17: 57,410,844	E314G	probably benign	Het
Adgre1	A	G	17: 57,420,399	E443G	probably benign	Het
Akp3	A	G	1: 87,125,631	Y102C	probably damaging	Het
Birc6	A	G	17: 74,579,531	N618S	probably benign	Het
Bpifc	A	G	10: 85,979,214	V296A	probably benign	Het
Cacna2d3	G	A	14: 28,969,318		probably benign	Het
Cacnb4	T	C	2: 52,474,954	N99S	probably damaging	Het
Cd38	A	G	5: 43,908,006	Y283C	probably damaging	Het
Celf4	T	A	18: 25,496,236	Q411L	probably damaging	Het
Cemip	A	T	7: 83,998,547	H108Q	probably damaging	Het
Col23a1	A	G	11: 51,561,893	E225G	unknown	Het
Dnah11	T	C	12: 118,060,310	E1902G	probably damaging	Het
Dst	A	G	1: 34,190,490	D2063G	probably damaging	Het
Fsip2	A	T	2: 82,992,840	I6306L	probably benign	Het
Furin	A	G	7: 80,391,090	S667P	possibly damaging	Het
Glmp	T	A	3: 88,325,832	S92R	probably benign	Het
Gm11563	C	G	11: 99,658,472	C152S	unknown	Het
Gm3486	A	G	14: 41,484,561	V185A	probably benign	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Hyal1	C	A	9: 107,579,170	A102E	probably damaging	Het
Invs	T	C	4: 48,421,785	C806R	probably benign	Het
L1td1	T	C	4: 98,733,696	V165A	probably benign	Het
Lama1	A	G	17: 67,813,866	T2666A		Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Lrrc8a	A	G	2: 30,256,227	Y351C	probably damaging	Het
Myh7b	T	C	2: 155,622,232	F551S	possibly damaging	Het
Myo19	A	G	11: 84,897,560	T333A	probably benign	Het
Oas2	T	C	5: 120,736,139	D543G	probably benign	Het
Olfr1040	A	G	2: 86,146,084	S217P	probably damaging	Het
Olfr117	A	G	17: 37,659,514	I273T	possibly damaging	Het
Pak7	A	G	2: 136,100,939	V427A	probably benign	Het
Pfas	G	A	11: 69,000,530	A247V	probably benign	Het
Psat1	T	A	19: 15,917,181	T115S	probably benign	Het
Psme4	T	A	11: 30,837,437	D1077E	probably benign	Het
Rabgap1l	A	G	1: 160,682,182	S442P	probably benign	Het
Ralgapa1	A	G	12: 55,776,191	M280T	possibly damaging	Het
Rb1cc1	A	T	1: 6,261,032	E394D	probably damaging	Het
Seh1l	T	C	18: 67,789,390	V271A	probably benign	Het
Sf3b1	A	T	1: 54,997,156	N919K	probably benign	Het
Sftpd	A	G	14: 41,174,492	S245P	possibly damaging	Het
Slc22a15	T	C	3: 101,924,114	E2G	probably damaging	Het
Spta1	A	G	1: 174,209,325	D1134G	possibly damaging	Het
Syna	A	G	5: 134,558,961	V378A	probably damaging	Het
Tchp	A	G	5: 114,709,350	K77E	possibly damaging	Het
Tescl	T	C	7: 24,333,531	N123S	probably benign	Het
Trio	C	T	15: 27,824,090	R1443Q	probably damaging	Het
Trrap	A	T	5: 144,790,855	Y462F	possibly damaging	Het
Vmn1r78	A	G	7: 12,152,905	T148A	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het

Other mutations in Nrp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00765:Nrp2	APN	1	62704251	nonsense	probably null
IGL01912:Nrp2	APN	1	62771737	missense	probably damaging	1.00
IGL01996:Nrp2	APN	1	62749260	missense	probably damaging	1.00
IGL02184:Nrp2	APN	1	62718940	nonsense	probably null
IGL02682:Nrp2	APN	1	62771837	missense	probably benign	0.03
IGL02928:Nrp2	APN	1	62815446	missense	probably damaging	1.00
IGL03024:Nrp2	APN	1	62771734	missense	probably damaging	1.00
Euphorbia	UTSW	1	62762813	missense	probably benign	0.02
Sabra	UTSW	1	62783521	missense	probably damaging	1.00
R0068:Nrp2	UTSW	1	62745377	missense	possibly damaging	0.95
R0068:Nrp2	UTSW	1	62745377	missense	possibly damaging	0.95
R0683:Nrp2	UTSW	1	62744318	missense	probably benign	0.41
R0789:Nrp2	UTSW	1	62745450	missense	probably benign	0.44
R1418:Nrp2	UTSW	1	62783332	nonsense	probably null
R1468:Nrp2	UTSW	1	62738299	missense	probably damaging	1.00
R1468:Nrp2	UTSW	1	62738299	missense	probably damaging	1.00
R1544:Nrp2	UTSW	1	62762904	missense	probably damaging	1.00
R1645:Nrp2	UTSW	1	62785124	missense	probably damaging	0.97
R1677:Nrp2	UTSW	1	62783320	missense	probably benign	0.18
R1752:Nrp2	UTSW	1	62738441	missense	probably damaging	1.00
R1840:Nrp2	UTSW	1	62738339	missense	probably damaging	1.00
R1916:Nrp2	UTSW	1	62762747	missense	probably damaging	1.00
R1962:Nrp2	UTSW	1	62718931	missense	probably benign	0.03
R2108:Nrp2	UTSW	1	62744277	missense	probably damaging	1.00
R2164:Nrp2	UTSW	1	62744355	missense	probably damaging	1.00
R2216:Nrp2	UTSW	1	62762918	nonsense	probably null
R2679:Nrp2	UTSW	1	62785078	missense	probably benign	0.00
R4349:Nrp2	UTSW	1	62738417	missense	probably damaging	1.00
R4351:Nrp2	UTSW	1	62738417	missense	probably damaging	1.00
R4352:Nrp2	UTSW	1	62738417	missense	probably damaging	1.00
R4353:Nrp2	UTSW	1	62738417	missense	probably damaging	1.00
R4811:Nrp2	UTSW	1	62719081	missense	probably damaging	1.00
R5362:Nrp2	UTSW	1	62769062	missense	probably benign	0.01
R5387:Nrp2	UTSW	1	62762813	missense	probably benign	0.02
R5461:Nrp2	UTSW	1	62747211	nonsense	probably null
R5704:Nrp2	UTSW	1	62785108	missense	probably benign	0.00
R6143:Nrp2	UTSW	1	62760815	missense	probably damaging	1.00
R6303:Nrp2	UTSW	1	62745406	missense	probably damaging	1.00
R6304:Nrp2	UTSW	1	62745406	missense	probably damaging	1.00
R6376:Nrp2	UTSW	1	62719017	missense	possibly damaging	0.65
R7347:Nrp2	UTSW	1	62745504	missense	probably benign	0.04
R7393:Nrp2	UTSW	1	62745424	missense	probably damaging	0.98
R7593:Nrp2	UTSW	1	62719044	missense	probably damaging	0.96
R7881:Nrp2	UTSW	1	62771831	missense	probably benign	0.42
R7882:Nrp2	UTSW	1	62783521	missense	probably damaging	1.00
R7948:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R7958:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R7959:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R7960:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R7961:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8009:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8012:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8014:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8015:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8068:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8069:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8070:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8071:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8206:Nrp2	UTSW	1	62747215	missense	probably damaging	1.00
R8791:Nrp2	UTSW	1	62749197	missense	probably damaging	1.00
R9090:Nrp2	UTSW	1	62745511	missense	probably benign	0.21
R9271:Nrp2	UTSW	1	62745511	missense	probably benign	0.21
R9287:Nrp2	UTSW	1	62795855	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGCTCTCAGCCCAGAAGC -3'
(R):5'- CATGTTTCACCAGAACCGCC -3'

Sequencing Primer
(F):5'- TTTCCAGTTAGAGCAGGATGAG -3'
(R):5'- CAGAACCGCCGCTCCTG -3'

Posted On

2018-11-28