Mutagenetix > Incidental Mutations

Incidental Mutation 'R6945:Rabgap1l'

540821

Institutional Source

Beutler Lab

Gene Symbol

Rabgap1l

Ensembl Gene

ENSMUSG00000026721

Gene Name

RAB GTPase activating protein 1-like

Synonyms

Hh1, 8430421H08Rik, 5830411O09Rik, 9630005B12Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6945 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

160219174-160793211 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 160682182 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 442 (S442P)

Ref Sequence

ENSEMBL: ENSMUSP00000028049 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028049] [ENSMUST00000195442]

Predicted Effect

probably benign
Transcript: ENSMUST00000028049
AA Change: S442P

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000028049
Gene: ENSMUSG00000026721
AA Change: S442P

Domain	Start	End	E-Value	Type
low complexity region	113	124	N/A	INTRINSIC
PTB	127	260	4.47e-20	SMART
Pfam:DUF3694	290	421	8.1e-41	PFAM
low complexity region	483	496	N/A	INTRINSIC
TBC	535	747	5.13e-67	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000195442
AA Change: S414P

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000141666
Gene: ENSMUSG00000026721
AA Change: S414P

Domain	Start	End	E-Value	Type
low complexity region	85	96	N/A	INTRINSIC
PTB	99	232	4.47e-20	SMART
Pfam:DUF3694	262	394	1.4e-42	PFAM

Meta Mutation Damage Score

0.0890

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

96% (51/53)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap insertion are viable, fertile and overtly normal with no alterations in hematopoietic progenitor cell numbers or types. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	A	C	5: 109,676,845	N246K	probably benign	Het
AA792892	C	T	5: 94,383,631	H125Y	possibly damaging	Het
Abcc5	T	A	16: 20,400,009	T208S	probably benign	Het
Acaa2	A	G	18: 74,793,309	E112G	probably benign	Het
Adgrb1	A	G	15: 74,550,024	N881S	probably damaging	Het
Adgre1	A	G	17: 57,410,844	E314G	probably benign	Het
Adgre1	A	G	17: 57,420,399	E443G	probably benign	Het
Akp3	A	G	1: 87,125,631	Y102C	probably damaging	Het
Birc6	A	G	17: 74,579,531	N618S	probably benign	Het
Bpifc	A	G	10: 85,979,214	V296A	probably benign	Het
Cacna2d3	G	A	14: 28,969,318		probably benign	Het
Cacnb4	T	C	2: 52,474,954	N99S	probably damaging	Het
Cd38	A	G	5: 43,908,006	Y283C	probably damaging	Het
Celf4	T	A	18: 25,496,236	Q411L	probably damaging	Het
Cemip	A	T	7: 83,998,547	H108Q	probably damaging	Het
Col23a1	A	G	11: 51,561,893	E225G	unknown	Het
Dnah11	T	C	12: 118,060,310	E1902G	probably damaging	Het
Dst	A	G	1: 34,190,490	D2063G	probably damaging	Het
Fsip2	A	T	2: 82,992,840	I6306L	probably benign	Het
Furin	A	G	7: 80,391,090	S667P	possibly damaging	Het
Glmp	T	A	3: 88,325,832	S92R	probably benign	Het
Gm11563	C	G	11: 99,658,472	C152S	unknown	Het
Gm3486	A	G	14: 41,484,561	V185A	probably benign	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Hyal1	C	A	9: 107,579,170	A102E	probably damaging	Het
Invs	T	C	4: 48,421,785	C806R	probably benign	Het
L1td1	T	C	4: 98,733,696	V165A	probably benign	Het
Lama1	A	G	17: 67,813,866	T2666A		Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Lrrc8a	A	G	2: 30,256,227	Y351C	probably damaging	Het
Myh7b	T	C	2: 155,622,232	F551S	possibly damaging	Het
Myo19	A	G	11: 84,897,560	T333A	probably benign	Het
Nrp2	A	T	1: 62,760,788	N387I	probably damaging	Het
Oas2	T	C	5: 120,736,139	D543G	probably benign	Het
Olfr1040	A	G	2: 86,146,084	S217P	probably damaging	Het
Olfr117	A	G	17: 37,659,514	I273T	possibly damaging	Het
Pak7	A	G	2: 136,100,939	V427A	probably benign	Het
Pfas	G	A	11: 69,000,530	A247V	probably benign	Het
Psat1	T	A	19: 15,917,181	T115S	probably benign	Het
Psme4	T	A	11: 30,837,437	D1077E	probably benign	Het
Ralgapa1	A	G	12: 55,776,191	M280T	possibly damaging	Het
Rb1cc1	A	T	1: 6,261,032	E394D	probably damaging	Het
Seh1l	T	C	18: 67,789,390	V271A	probably benign	Het
Sf3b1	A	T	1: 54,997,156	N919K	probably benign	Het
Sftpd	A	G	14: 41,174,492	S245P	possibly damaging	Het
Slc22a15	T	C	3: 101,924,114	E2G	probably damaging	Het
Spta1	A	G	1: 174,209,325	D1134G	possibly damaging	Het
Syna	A	G	5: 134,558,961	V378A	probably damaging	Het
Tchp	A	G	5: 114,709,350	K77E	possibly damaging	Het
Tescl	T	C	7: 24,333,531	N123S	probably benign	Het
Trio	C	T	15: 27,824,090	R1443Q	probably damaging	Het
Trrap	A	T	5: 144,790,855	Y462F	possibly damaging	Het
Vmn1r78	A	G	7: 12,152,905	T148A	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het

Other mutations in Rabgap1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Rabgap1l	APN	1	160738969	missense	probably benign	0.02
IGL01309:Rabgap1l	APN	1	160700798	missense	probably benign	0.00
IGL01448:Rabgap1l	APN	1	160740745	splice site	probably benign
IGL01886:Rabgap1l	APN	1	160342042	missense	probably damaging	1.00
IGL02010:Rabgap1l	APN	1	160472071	missense	probably damaging	0.99
IGL02079:Rabgap1l	APN	1	160738970	missense	probably benign	0.00
IGL02800:Rabgap1l	APN	1	160472053	missense	possibly damaging	0.73
IGL03343:Rabgap1l	APN	1	160443283	missense	probably benign
IGL03388:Rabgap1l	APN	1	160733523	splice site	probably null
IGL03406:Rabgap1l	APN	1	160722169	missense	probably damaging	1.00
amerigo	UTSW	1	160724036	missense	probably damaging	1.00
hispaniola	UTSW	1	160645307	critical splice donor site	probably null
R0047:Rabgap1l	UTSW	1	160231789	splice site	probably benign
R0047:Rabgap1l	UTSW	1	160231789	splice site	probably benign
R0048:Rabgap1l	UTSW	1	160627369	splice site	probably benign
R0099:Rabgap1l	UTSW	1	160682116	missense	possibly damaging	0.89
R0201:Rabgap1l	UTSW	1	160453745	splice site	probably benign
R0432:Rabgap1l	UTSW	1	160722205	missense	probably benign	0.10
R1104:Rabgap1l	UTSW	1	160231875	splice site	probably benign
R1220:Rabgap1l	UTSW	1	160738909	missense	probably damaging	1.00
R1485:Rabgap1l	UTSW	1	160733680	missense	probably benign	0.06
R1569:Rabgap1l	UTSW	1	160702390	missense	probably benign	0.08
R1907:Rabgap1l	UTSW	1	160645310	missense	probably benign	0.07
R2128:Rabgap1l	UTSW	1	160738957	missense	probably benign	0.00
R2129:Rabgap1l	UTSW	1	160738957	missense	probably benign	0.00
R2177:Rabgap1l	UTSW	1	160724062	missense	possibly damaging	0.89
R4636:Rabgap1l	UTSW	1	160342090	splice site	probably null
R4722:Rabgap1l	UTSW	1	160342164	missense	possibly damaging	0.81
R4743:Rabgap1l	UTSW	1	160453783	missense	probably damaging	1.00
R4913:Rabgap1l	UTSW	1	160238541	missense	probably damaging	1.00
R4915:Rabgap1l	UTSW	1	160441842	missense	probably benign	0.01
R5035:Rabgap1l	UTSW	1	160724036	missense	probably damaging	1.00
R5087:Rabgap1l	UTSW	1	160722239	missense	probably damaging	1.00
R5437:Rabgap1l	UTSW	1	160722147	missense	probably damaging	1.00
R5507:Rabgap1l	UTSW	1	160351328	missense	possibly damaging	0.83
R5619:Rabgap1l	UTSW	1	160238572	missense	probably benign	0.00
R5691:Rabgap1l	UTSW	1	160735684	missense	probably damaging	1.00
R5837:Rabgap1l	UTSW	1	160307222	utr 3 prime	probably benign
R5881:Rabgap1l	UTSW	1	160342113	missense	probably damaging	1.00
R6045:Rabgap1l	UTSW	1	160645323	missense	probably benign	0.00
R6243:Rabgap1l	UTSW	1	160645307	critical splice donor site	probably null
R6294:Rabgap1l	UTSW	1	160231849	missense	probably benign	0.14
R6452:Rabgap1l	UTSW	1	160453761	missense	probably damaging	1.00
R6802:Rabgap1l	UTSW	1	160733680	missense	probably benign	0.06
R7014:Rabgap1l	UTSW	1	160342072	missense	probably damaging	1.00
R7062:Rabgap1l	UTSW	1	160226650	missense	probably benign
R7089:Rabgap1l	UTSW	1	160724172	nonsense	probably null
R7170:Rabgap1l	UTSW	1	160645365	missense	probably damaging	1.00
R7172:Rabgap1l	UTSW	1	160733586	missense	probably benign	0.05
R7303:Rabgap1l	UTSW	1	160682097	missense	probably benign	0.01
R7357:Rabgap1l	UTSW	1	160342038	missense	probably damaging	1.00
R7466:Rabgap1l	UTSW	1	160226484	critical splice donor site	probably null
R7501:Rabgap1l	UTSW	1	160700788	missense	probably damaging	0.98
R7565:Rabgap1l	UTSW	1	160251417	missense
R7582:Rabgap1l	UTSW	1	160682084	missense	probably benign
R7740:Rabgap1l	UTSW	1	160682103	missense	probably benign	0.01
R7978:Rabgap1l	UTSW	1	160251268	missense
R7993:Rabgap1l	UTSW	1	160700854	missense	probably damaging	1.00
R8116:Rabgap1l	UTSW	1	160702442	missense	probably benign	0.22
R8672:Rabgap1l	UTSW	1	160443276	missense	probably damaging	1.00
Z1177:Rabgap1l	UTSW	1	160739073	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- TGTGTGCACCACTTTTGAAGATTC -3'
(R):5'- GGAACTTTCGGGATAGCATTTGAAATG -3'

Sequencing Primer
(F):5'- ACCACTTTTGAAGATTCTAAGAAAGC -3'
(R):5'- CGGGATAGCATTTGAAATGTAAATG -3'

Posted On

2018-11-28