Mutagenetix > Incidental Mutations

Incidental Mutation 'R6945:Lrrc8a'

540823

Institutional Source

Beutler Lab

Gene Symbol

Lrrc8a

Ensembl Gene

ENSMUSG00000007476

Gene Name

leucine rich repeat containing 8A

Synonyms

Lrrc8

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6945 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30237715-30263790 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30256227 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 351 (Y351C)

Ref Sequence

ENSEMBL: ENSMUSP00000139038 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095078] [ENSMUST00000113654] [ENSMUST00000139454]

Predicted Effect

probably damaging
Transcript: ENSMUST00000095078
AA Change: Y351C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092690
Gene: ENSMUSG00000007476
AA Change: Y351C

Domain	Start	End	E-Value	Type
Pfam:Pannexin_like	1	340	1.4e-146	PFAM
low complexity region	445	455	N/A	INTRINSIC
internal_repeat_1	461	526	7.6e-5	PROSPERO
low complexity region	540	558	N/A	INTRINSIC
LRR	590	613	5.41e0	SMART
LRR	614	636	3.18e2	SMART
LRR	638	660	6.78e1	SMART
LRR_TYP	661	684	1.06e-4	SMART
LRR	685	706	1.15e1	SMART
LRR_TYP	707	730	1.92e-2	SMART
LRR	731	751	1.81e2	SMART
LRR	753	776	2.02e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113654
AA Change: Y351C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109284
Gene: ENSMUSG00000007476
AA Change: Y351C

Domain	Start	End	E-Value	Type
Pfam:DUF3733	1	65	3.3e-32	PFAM
Pfam:DUF3733	97	156	2e-22	PFAM
transmembrane domain	320	342	N/A	INTRINSIC
low complexity region	445	455	N/A	INTRINSIC
internal_repeat_1	461	526	7.6e-5	PROSPERO
low complexity region	540	558	N/A	INTRINSIC
LRR	590	613	5.41e0	SMART
LRR	614	636	3.18e2	SMART
LRR	638	660	6.78e1	SMART
LRR_TYP	661	684	1.06e-4	SMART
LRR	685	706	1.15e1	SMART
LRR_TYP	707	730	1.92e-2	SMART
LRR	731	751	1.81e2	SMART
LRR	753	776	2.02e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000139454
AA Change: Y351C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139038
Gene: ENSMUSG00000099041
AA Change: Y351C

Domain	Start	End	E-Value	Type
Pfam:DUF3733	1	65	3.3e-32	PFAM
Pfam:DUF3733	97	156	2e-22	PFAM
transmembrane domain	320	342	N/A	INTRINSIC
low complexity region	445	455	N/A	INTRINSIC
internal_repeat_1	461	526	7.6e-5	PROSPERO
low complexity region	540	558	N/A	INTRINSIC
LRR	590	613	5.41e0	SMART
LRR	614	636	3.18e2	SMART
LRR	638	660	6.78e1	SMART
LRR_TYP	661	684	1.06e-4	SMART
LRR	685	706	1.15e1	SMART
LRR_TYP	707	730	1.92e-2	SMART
LRR	731	751	1.81e2	SMART
LRR	753	776	2.02e-1	SMART

Meta Mutation Damage Score

0.6159

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

96% (51/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the leucine-rich repeat family of proteins, which are involved in diverse biological processes, including cell adhesion, cellular trafficking, and hormone-receptor interactions. This family member is a putative four-pass transmembrane protein that plays a role in B cell development. Defects in this gene cause autosomal dominant non-Bruton type agammaglobulinemia, an immunodeficiency disease resulting from defects in B cell maturation. Multiple alternatively spliced transcript variants, which encode the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous for a knock-out allele exhibit prenatal lethality and premature death, growth retardation, sterility, multiple tissue abnormalities, a severe block in early thymic development, and impaired peripheral T cell function. B cell development is modestly impaired but B cell function is normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	A	C	5: 109,676,845	N246K	probably benign	Het
AA792892	C	T	5: 94,383,631	H125Y	possibly damaging	Het
Abcc5	T	A	16: 20,400,009	T208S	probably benign	Het
Acaa2	A	G	18: 74,793,309	E112G	probably benign	Het
Adgrb1	A	G	15: 74,550,024	N881S	probably damaging	Het
Adgre1	A	G	17: 57,410,844	E314G	probably benign	Het
Adgre1	A	G	17: 57,420,399	E443G	probably benign	Het
Akp3	A	G	1: 87,125,631	Y102C	probably damaging	Het
Birc6	A	G	17: 74,579,531	N618S	probably benign	Het
Bpifc	A	G	10: 85,979,214	V296A	probably benign	Het
Cacna2d3	G	A	14: 28,969,318		probably benign	Het
Cacnb4	T	C	2: 52,474,954	N99S	probably damaging	Het
Cd38	A	G	5: 43,908,006	Y283C	probably damaging	Het
Celf4	T	A	18: 25,496,236	Q411L	probably damaging	Het
Cemip	A	T	7: 83,998,547	H108Q	probably damaging	Het
Col23a1	A	G	11: 51,561,893	E225G	unknown	Het
Dnah11	T	C	12: 118,060,310	E1902G	probably damaging	Het
Dst	A	G	1: 34,190,490	D2063G	probably damaging	Het
Fsip2	A	T	2: 82,992,840	I6306L	probably benign	Het
Furin	A	G	7: 80,391,090	S667P	possibly damaging	Het
Glmp	T	A	3: 88,325,832	S92R	probably benign	Het
Gm11563	C	G	11: 99,658,472	C152S	unknown	Het
Gm3486	A	G	14: 41,484,561	V185A	probably benign	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Hyal1	C	A	9: 107,579,170	A102E	probably damaging	Het
Invs	T	C	4: 48,421,785	C806R	probably benign	Het
L1td1	T	C	4: 98,733,696	V165A	probably benign	Het
Lama1	A	G	17: 67,813,866	T2666A		Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Myh7b	T	C	2: 155,622,232	F551S	possibly damaging	Het
Myo19	A	G	11: 84,897,560	T333A	probably benign	Het
Nrp2	A	T	1: 62,760,788	N387I	probably damaging	Het
Oas2	T	C	5: 120,736,139	D543G	probably benign	Het
Olfr1040	A	G	2: 86,146,084	S217P	probably damaging	Het
Olfr117	A	G	17: 37,659,514	I273T	possibly damaging	Het
Pak7	A	G	2: 136,100,939	V427A	probably benign	Het
Pfas	G	A	11: 69,000,530	A247V	probably benign	Het
Psat1	T	A	19: 15,917,181	T115S	probably benign	Het
Psme4	T	A	11: 30,837,437	D1077E	probably benign	Het
Rabgap1l	A	G	1: 160,682,182	S442P	probably benign	Het
Ralgapa1	A	G	12: 55,776,191	M280T	possibly damaging	Het
Rb1cc1	A	T	1: 6,261,032	E394D	probably damaging	Het
Seh1l	T	C	18: 67,789,390	V271A	probably benign	Het
Sf3b1	A	T	1: 54,997,156	N919K	probably benign	Het
Sftpd	A	G	14: 41,174,492	S245P	possibly damaging	Het
Slc22a15	T	C	3: 101,924,114	E2G	probably damaging	Het
Spta1	A	G	1: 174,209,325	D1134G	possibly damaging	Het
Syna	A	G	5: 134,558,961	V378A	probably damaging	Het
Tchp	A	G	5: 114,709,350	K77E	possibly damaging	Het
Tescl	T	C	7: 24,333,531	N123S	probably benign	Het
Trio	C	T	15: 27,824,090	R1443Q	probably damaging	Het
Trrap	A	T	5: 144,790,855	Y462F	possibly damaging	Het
Vmn1r78	A	G	7: 12,152,905	T148A	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het

Other mutations in Lrrc8a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Lrrc8a	APN	2	30255315	missense	probably benign	0.32
IGL01161:Lrrc8a	APN	2	30255810	missense	probably damaging	1.00
IGL01419:Lrrc8a	APN	2	30257099	missense	probably benign	0.09
IGL01757:Lrrc8a	APN	2	30255525	missense	possibly damaging	0.81
IGL02390:Lrrc8a	APN	2	30256701	missense	probably damaging	1.00
IGL02608:Lrrc8a	APN	2	30256299	missense	possibly damaging	0.91
IGL02938:Lrrc8a	APN	2	30255686	missense	probably damaging	1.00
IGL02960:Lrrc8a	APN	2	30257013	missense	probably damaging	1.00
IGL03139:Lrrc8a	APN	2	30255671	missense	probably damaging	1.00
IGL03166:Lrrc8a	APN	2	30255365	missense	probably benign
R0033:Lrrc8a	UTSW	2	30255345	missense	probably damaging	1.00
R0033:Lrrc8a	UTSW	2	30255345	missense	probably damaging	1.00
R0276:Lrrc8a	UTSW	2	30256788	missense	possibly damaging	0.54
R0432:Lrrc8a	UTSW	2	30257067	missense	probably damaging	1.00
R0751:Lrrc8a	UTSW	2	30256350	missense	possibly damaging	0.82
R1924:Lrrc8a	UTSW	2	30255250	missense	probably damaging	1.00
R2029:Lrrc8a	UTSW	2	30256649	missense	probably damaging	1.00
R3852:Lrrc8a	UTSW	2	30261960	missense	probably benign	0.30
R4898:Lrrc8a	UTSW	2	30257202	missense	probably benign	0.00
R5175:Lrrc8a	UTSW	2	30255512	missense	probably damaging	1.00
R5616:Lrrc8a	UTSW	2	30255354	missense	probably benign	0.09
R5874:Lrrc8a	UTSW	2	30257136	missense	probably damaging	1.00
R6228:Lrrc8a	UTSW	2	30256553	missense	possibly damaging	0.82
R6406:Lrrc8a	UTSW	2	30257091	missense	possibly damaging	0.56
R6456:Lrrc8a	UTSW	2	30255474	missense	probably benign	0.14
R6833:Lrrc8a	UTSW	2	30255647	missense	possibly damaging	0.92
R6834:Lrrc8a	UTSW	2	30255647	missense	possibly damaging	0.92
R7675:Lrrc8a	UTSW	2	30255668	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTACACCGTCTACTATGTGC -3'
(R):5'- AGCGTCCACTCGTTGTTGAG -3'

Sequencing Primer
(F):5'- CATCAAGTTCGACGTGGACTG -3'
(R):5'- CCACTCGTTGTTGAGGTTCAGC -3'

Posted On

2018-11-28