Incidental Mutation 'R6945:Lrrc8a'
ID540823
Institutional Source Beutler Lab
Gene Symbol Lrrc8a
Ensembl Gene ENSMUSG00000007476
Gene Nameleucine rich repeat containing 8A
SynonymsLrrc8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6945 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location30237715-30263790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30256227 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 351 (Y351C)
Ref Sequence ENSEMBL: ENSMUSP00000139038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095078] [ENSMUST00000113654] [ENSMUST00000139454]
Predicted Effect probably damaging
Transcript: ENSMUST00000095078
AA Change: Y351C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092690
Gene: ENSMUSG00000007476
AA Change: Y351C

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 340 1.4e-146 PFAM
low complexity region 445 455 N/A INTRINSIC
internal_repeat_1 461 526 7.6e-5 PROSPERO
low complexity region 540 558 N/A INTRINSIC
LRR 590 613 5.41e0 SMART
LRR 614 636 3.18e2 SMART
LRR 638 660 6.78e1 SMART
LRR_TYP 661 684 1.06e-4 SMART
LRR 685 706 1.15e1 SMART
LRR_TYP 707 730 1.92e-2 SMART
LRR 731 751 1.81e2 SMART
LRR 753 776 2.02e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113654
AA Change: Y351C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109284
Gene: ENSMUSG00000007476
AA Change: Y351C

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 3.3e-32 PFAM
Pfam:DUF3733 97 156 2e-22 PFAM
transmembrane domain 320 342 N/A INTRINSIC
low complexity region 445 455 N/A INTRINSIC
internal_repeat_1 461 526 7.6e-5 PROSPERO
low complexity region 540 558 N/A INTRINSIC
LRR 590 613 5.41e0 SMART
LRR 614 636 3.18e2 SMART
LRR 638 660 6.78e1 SMART
LRR_TYP 661 684 1.06e-4 SMART
LRR 685 706 1.15e1 SMART
LRR_TYP 707 730 1.92e-2 SMART
LRR 731 751 1.81e2 SMART
LRR 753 776 2.02e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139454
AA Change: Y351C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139038
Gene: ENSMUSG00000099041
AA Change: Y351C

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 3.3e-32 PFAM
Pfam:DUF3733 97 156 2e-22 PFAM
transmembrane domain 320 342 N/A INTRINSIC
low complexity region 445 455 N/A INTRINSIC
internal_repeat_1 461 526 7.6e-5 PROSPERO
low complexity region 540 558 N/A INTRINSIC
LRR 590 613 5.41e0 SMART
LRR 614 636 3.18e2 SMART
LRR 638 660 6.78e1 SMART
LRR_TYP 661 684 1.06e-4 SMART
LRR 685 706 1.15e1 SMART
LRR_TYP 707 730 1.92e-2 SMART
LRR 731 751 1.81e2 SMART
LRR 753 776 2.02e-1 SMART
Meta Mutation Damage Score 0.6159 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the leucine-rich repeat family of proteins, which are involved in diverse biological processes, including cell adhesion, cellular trafficking, and hormone-receptor interactions. This family member is a putative four-pass transmembrane protein that plays a role in B cell development. Defects in this gene cause autosomal dominant non-Bruton type agammaglobulinemia, an immunodeficiency disease resulting from defects in B cell maturation. Multiple alternatively spliced transcript variants, which encode the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous for a knock-out allele exhibit prenatal lethality and premature death, growth retardation, sterility, multiple tissue abnormalities, a severe block in early thymic development, and impaired peripheral T cell function. B cell development is modestly impaired but B cell function is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,676,845 N246K probably benign Het
AA792892 C T 5: 94,383,631 H125Y possibly damaging Het
Abcc5 T A 16: 20,400,009 T208S probably benign Het
Acaa2 A G 18: 74,793,309 E112G probably benign Het
Adgrb1 A G 15: 74,550,024 N881S probably damaging Het
Adgre1 A G 17: 57,410,844 E314G probably benign Het
Adgre1 A G 17: 57,420,399 E443G probably benign Het
Akp3 A G 1: 87,125,631 Y102C probably damaging Het
Birc6 A G 17: 74,579,531 N618S probably benign Het
Bpifc A G 10: 85,979,214 V296A probably benign Het
Cacna2d3 G A 14: 28,969,318 probably benign Het
Cacnb4 T C 2: 52,474,954 N99S probably damaging Het
Cd38 A G 5: 43,908,006 Y283C probably damaging Het
Celf4 T A 18: 25,496,236 Q411L probably damaging Het
Cemip A T 7: 83,998,547 H108Q probably damaging Het
Col23a1 A G 11: 51,561,893 E225G unknown Het
Dnah11 T C 12: 118,060,310 E1902G probably damaging Het
Dst A G 1: 34,190,490 D2063G probably damaging Het
Fsip2 A T 2: 82,992,840 I6306L probably benign Het
Furin A G 7: 80,391,090 S667P possibly damaging Het
Glmp T A 3: 88,325,832 S92R probably benign Het
Gm11563 C G 11: 99,658,472 C152S unknown Het
Gm3486 A G 14: 41,484,561 V185A probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Hyal1 C A 9: 107,579,170 A102E probably damaging Het
Invs T C 4: 48,421,785 C806R probably benign Het
L1td1 T C 4: 98,733,696 V165A probably benign Het
Lama1 A G 17: 67,813,866 T2666A Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Myh7b T C 2: 155,622,232 F551S possibly damaging Het
Myo19 A G 11: 84,897,560 T333A probably benign Het
Nrp2 A T 1: 62,760,788 N387I probably damaging Het
Oas2 T C 5: 120,736,139 D543G probably benign Het
Olfr1040 A G 2: 86,146,084 S217P probably damaging Het
Olfr117 A G 17: 37,659,514 I273T possibly damaging Het
Pak7 A G 2: 136,100,939 V427A probably benign Het
Pfas G A 11: 69,000,530 A247V probably benign Het
Psat1 T A 19: 15,917,181 T115S probably benign Het
Psme4 T A 11: 30,837,437 D1077E probably benign Het
Rabgap1l A G 1: 160,682,182 S442P probably benign Het
Ralgapa1 A G 12: 55,776,191 M280T possibly damaging Het
Rb1cc1 A T 1: 6,261,032 E394D probably damaging Het
Seh1l T C 18: 67,789,390 V271A probably benign Het
Sf3b1 A T 1: 54,997,156 N919K probably benign Het
Sftpd A G 14: 41,174,492 S245P possibly damaging Het
Slc22a15 T C 3: 101,924,114 E2G probably damaging Het
Spta1 A G 1: 174,209,325 D1134G possibly damaging Het
Syna A G 5: 134,558,961 V378A probably damaging Het
Tchp A G 5: 114,709,350 K77E possibly damaging Het
Tescl T C 7: 24,333,531 N123S probably benign Het
Trio C T 15: 27,824,090 R1443Q probably damaging Het
Trrap A T 5: 144,790,855 Y462F possibly damaging Het
Vmn1r78 A G 7: 12,152,905 T148A probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Lrrc8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Lrrc8a APN 2 30255315 missense probably benign 0.32
IGL01161:Lrrc8a APN 2 30255810 missense probably damaging 1.00
IGL01419:Lrrc8a APN 2 30257099 missense probably benign 0.09
IGL01757:Lrrc8a APN 2 30255525 missense possibly damaging 0.81
IGL02390:Lrrc8a APN 2 30256701 missense probably damaging 1.00
IGL02608:Lrrc8a APN 2 30256299 missense possibly damaging 0.91
IGL02938:Lrrc8a APN 2 30255686 missense probably damaging 1.00
IGL02960:Lrrc8a APN 2 30257013 missense probably damaging 1.00
IGL03139:Lrrc8a APN 2 30255671 missense probably damaging 1.00
IGL03166:Lrrc8a APN 2 30255365 missense probably benign
R0033:Lrrc8a UTSW 2 30255345 missense probably damaging 1.00
R0033:Lrrc8a UTSW 2 30255345 missense probably damaging 1.00
R0276:Lrrc8a UTSW 2 30256788 missense possibly damaging 0.54
R0432:Lrrc8a UTSW 2 30257067 missense probably damaging 1.00
R0751:Lrrc8a UTSW 2 30256350 missense possibly damaging 0.82
R1924:Lrrc8a UTSW 2 30255250 missense probably damaging 1.00
R2029:Lrrc8a UTSW 2 30256649 missense probably damaging 1.00
R3852:Lrrc8a UTSW 2 30261960 missense probably benign 0.30
R4898:Lrrc8a UTSW 2 30257202 missense probably benign 0.00
R5175:Lrrc8a UTSW 2 30255512 missense probably damaging 1.00
R5616:Lrrc8a UTSW 2 30255354 missense probably benign 0.09
R5874:Lrrc8a UTSW 2 30257136 missense probably damaging 1.00
R6228:Lrrc8a UTSW 2 30256553 missense possibly damaging 0.82
R6406:Lrrc8a UTSW 2 30257091 missense possibly damaging 0.56
R6456:Lrrc8a UTSW 2 30255474 missense probably benign 0.14
R6833:Lrrc8a UTSW 2 30255647 missense possibly damaging 0.92
R6834:Lrrc8a UTSW 2 30255647 missense possibly damaging 0.92
R7675:Lrrc8a UTSW 2 30255668 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACACCGTCTACTATGTGC -3'
(R):5'- AGCGTCCACTCGTTGTTGAG -3'

Sequencing Primer
(F):5'- CATCAAGTTCGACGTGGACTG -3'
(R):5'- CCACTCGTTGTTGAGGTTCAGC -3'
Posted On2018-11-28