Incidental Mutation 'R6945:Myh7b'
ID540828
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Namemyosin, heavy chain 7B, cardiac muscle, beta
SynonymsMyh14
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6945 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location155611212-155634307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155622232 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 551 (F551S)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092995]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092995
AA Change: F551S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: F551S

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,676,845 N246K probably benign Het
AA792892 C T 5: 94,383,631 H125Y possibly damaging Het
Abcc5 T A 16: 20,400,009 T208S probably benign Het
Acaa2 A G 18: 74,793,309 E112G probably benign Het
Adgrb1 A G 15: 74,550,024 N881S probably damaging Het
Adgre1 A G 17: 57,410,844 E314G probably benign Het
Adgre1 A G 17: 57,420,399 E443G probably benign Het
Akp3 A G 1: 87,125,631 Y102C probably damaging Het
Birc6 A G 17: 74,579,531 N618S probably benign Het
Bpifc A G 10: 85,979,214 V296A probably benign Het
Cacna2d3 G A 14: 28,969,318 probably benign Het
Cacnb4 T C 2: 52,474,954 N99S probably damaging Het
Cd38 A G 5: 43,908,006 Y283C probably damaging Het
Celf4 T A 18: 25,496,236 Q411L probably damaging Het
Cemip A T 7: 83,998,547 H108Q probably damaging Het
Col23a1 A G 11: 51,561,893 E225G unknown Het
Dnah11 T C 12: 118,060,310 E1902G probably damaging Het
Dst A G 1: 34,190,490 D2063G probably damaging Het
Fsip2 A T 2: 82,992,840 I6306L probably benign Het
Furin A G 7: 80,391,090 S667P possibly damaging Het
Glmp T A 3: 88,325,832 S92R probably benign Het
Gm11563 C G 11: 99,658,472 C152S unknown Het
Gm3486 A G 14: 41,484,561 V185A probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Hyal1 C A 9: 107,579,170 A102E probably damaging Het
Invs T C 4: 48,421,785 C806R probably benign Het
L1td1 T C 4: 98,733,696 V165A probably benign Het
Lama1 A G 17: 67,813,866 T2666A Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc8a A G 2: 30,256,227 Y351C probably damaging Het
Myo19 A G 11: 84,897,560 T333A probably benign Het
Nrp2 A T 1: 62,760,788 N387I probably damaging Het
Oas2 T C 5: 120,736,139 D543G probably benign Het
Olfr1040 A G 2: 86,146,084 S217P probably damaging Het
Olfr117 A G 17: 37,659,514 I273T possibly damaging Het
Pak7 A G 2: 136,100,939 V427A probably benign Het
Pfas G A 11: 69,000,530 A247V probably benign Het
Psat1 T A 19: 15,917,181 T115S probably benign Het
Psme4 T A 11: 30,837,437 D1077E probably benign Het
Rabgap1l A G 1: 160,682,182 S442P probably benign Het
Ralgapa1 A G 12: 55,776,191 M280T possibly damaging Het
Rb1cc1 A T 1: 6,261,032 E394D probably damaging Het
Seh1l T C 18: 67,789,390 V271A probably benign Het
Sf3b1 A T 1: 54,997,156 N919K probably benign Het
Sftpd A G 14: 41,174,492 S245P possibly damaging Het
Slc22a15 T C 3: 101,924,114 E2G probably damaging Het
Spta1 A G 1: 174,209,325 D1134G possibly damaging Het
Syna A G 5: 134,558,961 V378A probably damaging Het
Tchp A G 5: 114,709,350 K77E possibly damaging Het
Tescl T C 7: 24,333,531 N123S probably benign Het
Trio C T 15: 27,824,090 R1443Q probably damaging Het
Trrap A T 5: 144,790,855 Y462F possibly damaging Het
Vmn1r78 A G 7: 12,152,905 T148A probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155630292 missense probably damaging 0.99
IGL01604:Myh7b APN 2 155632407 missense probably damaging 0.96
IGL02179:Myh7b APN 2 155614491 missense probably benign 0.02
IGL02729:Myh7b APN 2 155625689 missense probably damaging 1.00
IGL02804:Myh7b APN 2 155625723 missense probably damaging 1.00
IGL02851:Myh7b APN 2 155628827 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155632903 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155625954 missense possibly damaging 0.95
IGL02992:Myh7b APN 2 155621410 missense probably damaging 0.99
IGL03060:Myh7b APN 2 155632751 missense probably damaging 1.00
IGL03061:Myh7b APN 2 155620111 missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155620483 nonsense probably null
IGL03246:Myh7b APN 2 155617872 missense probably damaging 1.00
IGL03382:Myh7b APN 2 155623479 missense probably damaging 1.00
euclidian UTSW 2 155633399 missense probably benign 0.32
imaginary UTSW 2 155632255 missense probably benign 0.36
Irrational UTSW 2 155630672 unclassified probably benign
muscoli UTSW 2 155620118 nonsense probably null
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0109:Myh7b UTSW 2 155611674 missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155630672 unclassified probably benign
R0567:Myh7b UTSW 2 155626398 missense probably damaging 1.00
R0619:Myh7b UTSW 2 155611722 missense probably benign 0.00
R0927:Myh7b UTSW 2 155620120 missense probably damaging 1.00
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0974:Myh7b UTSW 2 155620427 missense probably benign
R1137:Myh7b UTSW 2 155622714 missense probably damaging 1.00
R1261:Myh7b UTSW 2 155621083 missense probably benign 0.00
R1268:Myh7b UTSW 2 155614046 nonsense probably null
R1537:Myh7b UTSW 2 155631787 missense probably damaging 0.96
R1632:Myh7b UTSW 2 155620525 missense probably benign 0.04
R1694:Myh7b UTSW 2 155613193 missense probably damaging 0.99
R1697:Myh7b UTSW 2 155620134 missense probably damaging 1.00
R1730:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155630858 missense probably damaging 0.96
R1783:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155629457 missense probably benign 0.00
R2140:Myh7b UTSW 2 155620123 missense probably damaging 1.00
R2971:Myh7b UTSW 2 155632255 missense probably benign 0.36
R3838:Myh7b UTSW 2 155632989 missense probably damaging 1.00
R4074:Myh7b UTSW 2 155618758 missense probably damaging 0.96
R4191:Myh7b UTSW 2 155633399 missense probably benign 0.32
R4689:Myh7b UTSW 2 155630514 missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155614177 missense probably damaging 1.00
R4697:Myh7b UTSW 2 155629322 missense probably damaging 1.00
R4771:Myh7b UTSW 2 155626394 nonsense probably null
R4794:Myh7b UTSW 2 155623266 missense probably benign 0.00
R4842:Myh7b UTSW 2 155633989 missense probably benign 0.45
R4871:Myh7b UTSW 2 155613500 missense probably benign 0.18
R5022:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155631750 missense probably benign 0.00
R5055:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155632314 missense probably benign
R5422:Myh7b UTSW 2 155631034 missense probably damaging 0.99
R5505:Myh7b UTSW 2 155632672 missense probably benign 0.01
R5946:Myh7b UTSW 2 155621395 missense probably damaging 1.00
R6089:Myh7b UTSW 2 155622489 missense probably damaging 1.00
R6103:Myh7b UTSW 2 155618743 missense probably damaging 1.00
R6233:Myh7b UTSW 2 155631799 missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155632396 missense probably damaging 1.00
R6350:Myh7b UTSW 2 155628760 missense probably benign 0.00
R6484:Myh7b UTSW 2 155628643 missense probably benign 0.05
R6760:Myh7b UTSW 2 155620118 nonsense probably null
R6896:Myh7b UTSW 2 155622568 critical splice donor site probably null
R7020:Myh7b UTSW 2 155631751 missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155614133 missense probably damaging 1.00
R7102:Myh7b UTSW 2 155622199 missense probably damaging 1.00
R7248:Myh7b UTSW 2 155622186 missense probably damaging 1.00
R7303:Myh7b UTSW 2 155618740 missense probably damaging 1.00
R7360:Myh7b UTSW 2 155632540 missense probably benign 0.38
R7652:Myh7b UTSW 2 155632236 missense probably damaging 0.99
R7703:Myh7b UTSW 2 155620436 missense probably null 1.00
R7711:Myh7b UTSW 2 155620403 missense probably damaging 1.00
X0013:Myh7b UTSW 2 155631169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCTTGTGGACCTGAAAC -3'
(R):5'- GCCCACGATGCTATAAGGAAC -3'

Sequencing Primer
(F):5'- TTGTGGACCTGAAACAGCTC -3'
(R):5'- AATATTGACCCAGGTGGCGACC -3'
Posted On2018-11-28