Mutagenetix > Incidental Mutations

Incidental Mutation 'R6945:Cd38'

540833

Institutional Source

Beutler Lab

Gene Symbol

Cd38

Ensembl Gene

ENSMUSG00000029084

Gene Name

CD38 antigen

Synonyms

Cd38-rs1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6945 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43868553-43912375 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43908006 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 283 (Y283C)

Ref Sequence

ENSEMBL: ENSMUSP00000030964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030964]

PDB Structure

Crystal structure of the truncated extracellular domain of mouse CD38 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030964
AA Change: Y283C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030964
Gene: ENSMUSG00000029084
AA Change: Y283C

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
Pfam:Rib_hydrolayse	59	300	2.9e-104	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

96% (51/53)

MGI Phenotype

FUNCTION: This gene encodes a non-lineage-restricted, type II transmembrane glycoprotein that synthesizes and hydrolyzes cyclic adenosine 5'-diphosphate-ribose, an intracellular calcium ion mobilizing messenger. The release of soluble protein and the ability of membrane-bound protein to become internalized indicate both extracellular and intracellular functions for the protein. This protein has an N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites. Knockout mice deficient for this gene display altered humoral immune responses. In addition, knockout mice exhibit higher locomotor activity and defects in nurturing and social behaviors. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene has resulted in an impaired antibody response to T cell dependent antigens and disrupted glucose-dependent insulin secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	A	C	5: 109,676,845	N246K	probably benign	Het
AA792892	C	T	5: 94,383,631	H125Y	possibly damaging	Het
Abcc5	T	A	16: 20,400,009	T208S	probably benign	Het
Acaa2	A	G	18: 74,793,309	E112G	probably benign	Het
Adgrb1	A	G	15: 74,550,024	N881S	probably damaging	Het
Adgre1	A	G	17: 57,410,844	E314G	probably benign	Het
Adgre1	A	G	17: 57,420,399	E443G	probably benign	Het
Akp3	A	G	1: 87,125,631	Y102C	probably damaging	Het
Birc6	A	G	17: 74,579,531	N618S	probably benign	Het
Bpifc	A	G	10: 85,979,214	V296A	probably benign	Het
Cacna2d3	G	A	14: 28,969,318		probably benign	Het
Cacnb4	T	C	2: 52,474,954	N99S	probably damaging	Het
Celf4	T	A	18: 25,496,236	Q411L	probably damaging	Het
Cemip	A	T	7: 83,998,547	H108Q	probably damaging	Het
Col23a1	A	G	11: 51,561,893	E225G	unknown	Het
Dnah11	T	C	12: 118,060,310	E1902G	probably damaging	Het
Dst	A	G	1: 34,190,490	D2063G	probably damaging	Het
Fsip2	A	T	2: 82,992,840	I6306L	probably benign	Het
Furin	A	G	7: 80,391,090	S667P	possibly damaging	Het
Glmp	T	A	3: 88,325,832	S92R	probably benign	Het
Gm11563	C	G	11: 99,658,472	C152S	unknown	Het
Gm3486	A	G	14: 41,484,561	V185A	probably benign	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Hyal1	C	A	9: 107,579,170	A102E	probably damaging	Het
Invs	T	C	4: 48,421,785	C806R	probably benign	Het
L1td1	T	C	4: 98,733,696	V165A	probably benign	Het
Lama1	A	G	17: 67,813,866	T2666A		Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Lrrc8a	A	G	2: 30,256,227	Y351C	probably damaging	Het
Myh7b	T	C	2: 155,622,232	F551S	possibly damaging	Het
Myo19	A	G	11: 84,897,560	T333A	probably benign	Het
Nrp2	A	T	1: 62,760,788	N387I	probably damaging	Het
Oas2	T	C	5: 120,736,139	D543G	probably benign	Het
Olfr1040	A	G	2: 86,146,084	S217P	probably damaging	Het
Olfr117	A	G	17: 37,659,514	I273T	possibly damaging	Het
Pak7	A	G	2: 136,100,939	V427A	probably benign	Het
Pfas	G	A	11: 69,000,530	A247V	probably benign	Het
Psat1	T	A	19: 15,917,181	T115S	probably benign	Het
Psme4	T	A	11: 30,837,437	D1077E	probably benign	Het
Rabgap1l	A	G	1: 160,682,182	S442P	probably benign	Het
Ralgapa1	A	G	12: 55,776,191	M280T	possibly damaging	Het
Rb1cc1	A	T	1: 6,261,032	E394D	probably damaging	Het
Seh1l	T	C	18: 67,789,390	V271A	probably benign	Het
Sf3b1	A	T	1: 54,997,156	N919K	probably benign	Het
Sftpd	A	G	14: 41,174,492	S245P	possibly damaging	Het
Slc22a15	T	C	3: 101,924,114	E2G	probably damaging	Het
Spta1	A	G	1: 174,209,325	D1134G	possibly damaging	Het
Syna	A	G	5: 134,558,961	V378A	probably damaging	Het
Tchp	A	G	5: 114,709,350	K77E	possibly damaging	Het
Tescl	T	C	7: 24,333,531	N123S	probably benign	Het
Trio	C	T	15: 27,824,090	R1443Q	probably damaging	Het
Trrap	A	T	5: 144,790,855	Y462F	possibly damaging	Het
Vmn1r78	A	G	7: 12,152,905	T148A	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het

Other mutations in Cd38

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Cd38	APN	5	43903597	missense	probably benign	0.04
IGL01691:Cd38	APN	5	43903586	splice site	probably benign
IGL02585:Cd38	APN	5	43910302	missense	probably damaging	1.00
paradiso	UTSW	5	43903585	splice site	probably null
IGL02796:Cd38	UTSW	5	43906213	missense	probably damaging	1.00
R0496:Cd38	UTSW	5	43868891	missense	probably damaging	1.00
R0855:Cd38	UTSW	5	43903585	splice site	probably null
R1621:Cd38	UTSW	5	43901524	missense	probably benign	0.00
R2353:Cd38	UTSW	5	43908011	critical splice donor site	probably null
R2366:Cd38	UTSW	5	43903590	splice site	probably benign
R2860:Cd38	UTSW	5	43901433	missense	probably damaging	1.00
R2861:Cd38	UTSW	5	43901433	missense	probably damaging	1.00
R4342:Cd38	UTSW	5	43869089	missense	probably benign	0.00
R4343:Cd38	UTSW	5	43869089	missense	probably benign	0.00
R4344:Cd38	UTSW	5	43869089	missense	probably benign	0.00
R4953:Cd38	UTSW	5	43907545	missense	possibly damaging	0.73
R5007:Cd38	UTSW	5	43906164	missense	probably damaging	1.00
R5371:Cd38	UTSW	5	43868883	missense	probably benign	0.01
R5699:Cd38	UTSW	5	43900386	missense	probably damaging	1.00
R6857:Cd38	UTSW	5	43906198	missense	probably damaging	0.99
R7129:Cd38	UTSW	5	43910309	missense	probably benign	0.13
R7825:Cd38	UTSW	5	43901455	missense	probably damaging	1.00
R7852:Cd38	UTSW	5	43901448	missense	probably damaging	1.00
R7855:Cd38	UTSW	5	43901448	missense	probably damaging	1.00
R7894:Cd38	UTSW	5	43900404	missense	probably damaging	1.00
R7935:Cd38	UTSW	5	43901448	missense	probably damaging	1.00
R7938:Cd38	UTSW	5	43901448	missense	probably damaging	1.00
R7977:Cd38	UTSW	5	43900404	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACCTTTGCTCCTGGTGAC -3'
(R):5'- ACATCACTTAGGGCTGGCAG -3'

Sequencing Primer
(F):5'- TGGTGACCAGAGAAGCCC -3'
(R):5'- CTTAGGGCTGGCAGGCAAG -3'

Posted On

2018-11-28