Incidental Mutation 'R6945:5430403G16Rik'
ID 540835
Institutional Source Beutler Lab
Gene Symbol 5430403G16Rik
Ensembl Gene ENSMUSG00000072763
Gene Name RIKEN cDNA 5430403G16 gene
Synonyms ENSMUSG00000072763
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock # R6945 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 109674545-109691041 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 109676845 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 246 (N246K)
Ref Sequence ENSEMBL: ENSMUSP00000090395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092720]
AlphaFold D3Z5L4
Predicted Effect probably benign
Transcript: ENSMUST00000092720
AA Change: N246K

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090395
Gene: ENSMUSG00000072763
AA Change: N246K

DomainStartEndE-ValueType
KRAB 4 60 2.47e-14 SMART
ZnF_C2H2 131 153 3.39e-3 SMART
ZnF_C2H2 159 181 3.95e-4 SMART
ZnF_C2H2 187 209 3.95e-4 SMART
ZnF_C2H2 215 237 1.12e-3 SMART
ZnF_C2H2 243 265 4.01e-5 SMART
ZnF_C2H2 271 293 7.78e-3 SMART
ZnF_C2H2 299 321 2.61e-4 SMART
ZnF_C2H2 327 349 1.36e-2 SMART
ZnF_C2H2 355 377 7.37e-4 SMART
ZnF_C2H2 383 405 1.3e-4 SMART
ZnF_C2H2 411 433 3.69e-4 SMART
ZnF_C2H2 439 461 4.3e-5 SMART
ZnF_C2H2 467 489 2.57e-3 SMART
ZnF_C2H2 495 517 2.61e-4 SMART
ZnF_C2H2 523 545 2.05e-2 SMART
ZnF_C2H2 551 573 5.59e-4 SMART
ZnF_C2H2 579 601 1.58e-3 SMART
ZnF_C2H2 607 629 9.08e-4 SMART
ZnF_C2H2 635 657 3.44e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 C T 5: 94,383,631 H125Y possibly damaging Het
Abcc5 T A 16: 20,400,009 T208S probably benign Het
Acaa2 A G 18: 74,793,309 E112G probably benign Het
Adgrb1 A G 15: 74,550,024 N881S probably damaging Het
Adgre1 A G 17: 57,410,844 E314G probably benign Het
Adgre1 A G 17: 57,420,399 E443G probably benign Het
Akp3 A G 1: 87,125,631 Y102C probably damaging Het
Birc6 A G 17: 74,579,531 N618S probably benign Het
Bpifc A G 10: 85,979,214 V296A probably benign Het
Cacna2d3 G A 14: 28,969,318 probably benign Het
Cacnb4 T C 2: 52,474,954 N99S probably damaging Het
Cd38 A G 5: 43,908,006 Y283C probably damaging Het
Celf4 T A 18: 25,496,236 Q411L probably damaging Het
Cemip A T 7: 83,998,547 H108Q probably damaging Het
Col23a1 A G 11: 51,561,893 E225G unknown Het
Dnah11 T C 12: 118,060,310 E1902G probably damaging Het
Dst A G 1: 34,190,490 D2063G probably damaging Het
Fsip2 A T 2: 82,992,840 I6306L probably benign Het
Furin A G 7: 80,391,090 S667P possibly damaging Het
Glmp T A 3: 88,325,832 S92R probably benign Het
Gm11563 C G 11: 99,658,472 C152S unknown Het
Gm3486 A G 14: 41,484,561 V185A probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Hyal1 C A 9: 107,579,170 A102E probably damaging Het
Invs T C 4: 48,421,785 C806R probably benign Het
L1td1 T C 4: 98,733,696 V165A probably benign Het
Lama1 A G 17: 67,813,866 T2666A Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc8a A G 2: 30,256,227 Y351C probably damaging Het
Myh7b T C 2: 155,622,232 F551S possibly damaging Het
Myo19 A G 11: 84,897,560 T333A probably benign Het
Nrp2 A T 1: 62,760,788 N387I probably damaging Het
Oas2 T C 5: 120,736,139 D543G probably benign Het
Olfr1040 A G 2: 86,146,084 S217P probably damaging Het
Olfr117 A G 17: 37,659,514 I273T possibly damaging Het
Pak7 A G 2: 136,100,939 V427A probably benign Het
Pfas G A 11: 69,000,530 A247V probably benign Het
Psat1 T A 19: 15,917,181 T115S probably benign Het
Psme4 T A 11: 30,837,437 D1077E probably benign Het
Rabgap1l A G 1: 160,682,182 S442P probably benign Het
Ralgapa1 A G 12: 55,776,191 M280T possibly damaging Het
Rb1cc1 A T 1: 6,261,032 E394D probably damaging Het
Seh1l T C 18: 67,789,390 V271A probably benign Het
Sf3b1 A T 1: 54,997,156 N919K probably benign Het
Sftpd A G 14: 41,174,492 S245P possibly damaging Het
Slc22a15 T C 3: 101,924,114 E2G probably damaging Het
Spta1 A G 1: 174,209,325 D1134G possibly damaging Het
Syna A G 5: 134,558,961 V378A probably damaging Het
Tchp A G 5: 114,709,350 K77E possibly damaging Het
Tescl T C 7: 24,333,531 N123S probably benign Het
Trio C T 15: 27,824,090 R1443Q probably damaging Het
Trrap A T 5: 144,790,855 Y462F possibly damaging Het
Vmn1r78 A G 7: 12,152,905 T148A probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in 5430403G16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:5430403G16Rik APN 5 109677316 nonsense probably null
IGL02547:5430403G16Rik APN 5 109678762 critical splice donor site probably null
IGL02589:5430403G16Rik APN 5 109678520 missense possibly damaging 0.95
BB007:5430403G16Rik UTSW 5 109675756 nonsense probably null
BB017:5430403G16Rik UTSW 5 109675756 nonsense probably null
R0363:5430403G16Rik UTSW 5 109676888 missense probably benign 0.03
R0628:5430403G16Rik UTSW 5 109678576 critical splice acceptor site probably null
R2858:5430403G16Rik UTSW 5 109675953 missense probably benign 0.02
R4914:5430403G16Rik UTSW 5 109678530 missense probably damaging 1.00
R4945:5430403G16Rik UTSW 5 109677075 missense possibly damaging 0.60
R5444:5430403G16Rik UTSW 5 109675636 nonsense probably null
R6000:5430403G16Rik UTSW 5 109676864 missense probably benign 0.19
R6258:5430403G16Rik UTSW 5 109676567 missense probably benign 0.01
R6389:5430403G16Rik UTSW 5 109676019 missense possibly damaging 0.84
R7225:5430403G16Rik UTSW 5 109677149 missense possibly damaging 0.69
R7581:5430403G16Rik UTSW 5 109690788 start gained probably benign
R7810:5430403G16Rik UTSW 5 109677304 nonsense probably null
R7930:5430403G16Rik UTSW 5 109675756 nonsense probably null
R8821:5430403G16Rik UTSW 5 109676308 missense probably benign 0.00
R8825:5430403G16Rik UTSW 5 109678880 missense probably damaging 1.00
R8831:5430403G16Rik UTSW 5 109676308 missense probably benign 0.00
R9179:5430403G16Rik UTSW 5 109675842 missense probably damaging 1.00
R9429:5430403G16Rik UTSW 5 109676468 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCTTTGTCACATTGATCACATT -3'
(R):5'- ATGGTGAAGCCTTTGTACATCACA -3'

Sequencing Primer
(F):5'- GTCACATTGATCACATTCATAGGG -3'
(R):5'- TGGTAAAGCCTTTACAGGACACAGTC -3'
Posted On 2018-11-28