Incidental Mutation 'R6945:Tchp'
ID 540836
Institutional Source Beutler Lab
Gene Symbol Tchp
Ensembl Gene ENSMUSG00000002486
Gene Name trichoplein, keratin filament binding
Synonyms A930031F18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6945 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 114707760-114722327 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 114709350 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 77 (K77E)
Ref Sequence ENSEMBL: ENSMUSP00000092009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094441]
AlphaFold Q3TVW5
Predicted Effect possibly damaging
Transcript: ENSMUST00000094441
AA Change: K77E

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092009
Gene: ENSMUSG00000002486
AA Change: K77E

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
coiled coil region 69 140 N/A INTRINSIC
Pfam:TPH 145 485 1.5e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,676,845 N246K probably benign Het
AA792892 C T 5: 94,383,631 H125Y possibly damaging Het
Abcc5 T A 16: 20,400,009 T208S probably benign Het
Acaa2 A G 18: 74,793,309 E112G probably benign Het
Adgrb1 A G 15: 74,550,024 N881S probably damaging Het
Adgre1 A G 17: 57,410,844 E314G probably benign Het
Adgre1 A G 17: 57,420,399 E443G probably benign Het
Akp3 A G 1: 87,125,631 Y102C probably damaging Het
Birc6 A G 17: 74,579,531 N618S probably benign Het
Bpifc A G 10: 85,979,214 V296A probably benign Het
Cacna2d3 G A 14: 28,969,318 probably benign Het
Cacnb4 T C 2: 52,474,954 N99S probably damaging Het
Cd38 A G 5: 43,908,006 Y283C probably damaging Het
Celf4 T A 18: 25,496,236 Q411L probably damaging Het
Cemip A T 7: 83,998,547 H108Q probably damaging Het
Col23a1 A G 11: 51,561,893 E225G unknown Het
Dnah11 T C 12: 118,060,310 E1902G probably damaging Het
Dst A G 1: 34,190,490 D2063G probably damaging Het
Fsip2 A T 2: 82,992,840 I6306L probably benign Het
Furin A G 7: 80,391,090 S667P possibly damaging Het
Glmp T A 3: 88,325,832 S92R probably benign Het
Gm11563 C G 11: 99,658,472 C152S unknown Het
Gm3486 A G 14: 41,484,561 V185A probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Hyal1 C A 9: 107,579,170 A102E probably damaging Het
Invs T C 4: 48,421,785 C806R probably benign Het
L1td1 T C 4: 98,733,696 V165A probably benign Het
Lama1 A G 17: 67,813,866 T2666A Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc8a A G 2: 30,256,227 Y351C probably damaging Het
Myh7b T C 2: 155,622,232 F551S possibly damaging Het
Myo19 A G 11: 84,897,560 T333A probably benign Het
Nrp2 A T 1: 62,760,788 N387I probably damaging Het
Oas2 T C 5: 120,736,139 D543G probably benign Het
Olfr1040 A G 2: 86,146,084 S217P probably damaging Het
Olfr117 A G 17: 37,659,514 I273T possibly damaging Het
Pak7 A G 2: 136,100,939 V427A probably benign Het
Pfas G A 11: 69,000,530 A247V probably benign Het
Psat1 T A 19: 15,917,181 T115S probably benign Het
Psme4 T A 11: 30,837,437 D1077E probably benign Het
Rabgap1l A G 1: 160,682,182 S442P probably benign Het
Ralgapa1 A G 12: 55,776,191 M280T possibly damaging Het
Rb1cc1 A T 1: 6,261,032 E394D probably damaging Het
Seh1l T C 18: 67,789,390 V271A probably benign Het
Sf3b1 A T 1: 54,997,156 N919K probably benign Het
Sftpd A G 14: 41,174,492 S245P possibly damaging Het
Slc22a15 T C 3: 101,924,114 E2G probably damaging Het
Spta1 A G 1: 174,209,325 D1134G possibly damaging Het
Syna A G 5: 134,558,961 V378A probably damaging Het
Tescl T C 7: 24,333,531 N123S probably benign Het
Trio C T 15: 27,824,090 R1443Q probably damaging Het
Trrap A T 5: 144,790,855 Y462F possibly damaging Het
Vmn1r78 A G 7: 12,152,905 T148A probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Tchp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Tchp APN 5 114708733 missense probably benign 0.00
R0266:Tchp UTSW 5 114709333 missense possibly damaging 0.87
R0454:Tchp UTSW 5 114720182 missense probably benign 0.02
R0709:Tchp UTSW 5 114717453 missense probably damaging 1.00
R0725:Tchp UTSW 5 114719621 missense probably benign 0.04
R2680:Tchp UTSW 5 114709519 critical splice donor site probably null
R4604:Tchp UTSW 5 114719573 splice site probably null
R4956:Tchp UTSW 5 114719620 missense probably damaging 0.99
R6662:Tchp UTSW 5 114720015 splice site probably null
R7002:Tchp UTSW 5 114708796 missense probably benign 0.39
R7288:Tchp UTSW 5 114715569 missense probably damaging 1.00
R7447:Tchp UTSW 5 114715655 missense probably benign 0.00
R8021:Tchp UTSW 5 114718417 missense probably damaging 1.00
R8066:Tchp UTSW 5 114709411 missense probably benign 0.32
R8087:Tchp UTSW 5 114719604 missense probably damaging 1.00
R8403:Tchp UTSW 5 114708766 missense possibly damaging 0.87
R9053:Tchp UTSW 5 114715855 missense probably benign 0.22
R9149:Tchp UTSW 5 114721123 nonsense probably null
R9311:Tchp UTSW 5 114708816 missense probably benign 0.02
R9436:Tchp UTSW 5 114709385 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGCTGGGGAGAAGTACTGTAC -3'
(R):5'- TTCCGGACTAGGGTAGTTACC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- GGTAGTTACCAGCTTCCTCTG -3'
Posted On 2018-11-28