Mutagenetix > Incidental Mutations

Incidental Mutation 'R6945:Oas2'

540837

Institutional Source

Beutler Lab

Gene Symbol

Oas2

Ensembl Gene

ENSMUSG00000032690

Gene Name

2'-5' oligoadenylate synthetase 2

Synonyms

2'-5' oligoadenylate synthetase-like 11, Oasl11

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R6945 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120730333-120749853 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120736139 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 543 (D543G)

Ref Sequence

ENSEMBL: ENSMUSP00000060082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053909] [ENSMUST00000081491]

Predicted Effect

probably benign
Transcript: ENSMUST00000053909
AA Change: D543G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000060082
Gene: ENSMUSG00000032690
AA Change: D543G

Domain	Start	End	E-Value	Type
low complexity region	10	33	N/A	INTRINSIC
Pfam:OAS1_C	190	378	5.6e-75	PFAM
Pfam:NTP_transf_2	412	516	4e-9	PFAM
Pfam:OAS1_C	533	724	3.2e-86	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000081491
AA Change: D543G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000080209
Gene: ENSMUSG00000032690
AA Change: D543G

Domain	Start	End	E-Value	Type
low complexity region	10	33	N/A	INTRINSIC
Pfam:OAS1_C	191	376	1.9e-77	PFAM
Pfam:NTP_transf_2	412	516	1.3e-10	PFAM
Pfam:OAS1_C	534	722	2.6e-87	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122053
Gene: ENSMUSG00000032690
AA Change: D53G

Domain	Start	End	E-Value	Type
Pfam:OAS1_C	45	233	2.8e-88	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

96% (51/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 2-5A synthetase family, essential proteins involved in the innate immune response to viral infection. The encoded protein is induced by interferons and uses adenosine triphosphate in 2'-specific nucleotidyl transfer reactions to synthesize 2',5'-oligoadenylates (2-5As). These molecules activate latent RNase L, which results in viral RNA degradation and the inhibition of viral replication. The three known members of this gene family are located in a cluster on chromosome 12. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: In nursing mothers, homozygous knockout (by a point mutation in a critical domain) results in a failure of the alveoli to expand and a failure to lactate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	A	C	5: 109,676,845	N246K	probably benign	Het
AA792892	C	T	5: 94,383,631	H125Y	possibly damaging	Het
Abcc5	T	A	16: 20,400,009	T208S	probably benign	Het
Acaa2	A	G	18: 74,793,309	E112G	probably benign	Het
Adgrb1	A	G	15: 74,550,024	N881S	probably damaging	Het
Adgre1	A	G	17: 57,410,844	E314G	probably benign	Het
Adgre1	A	G	17: 57,420,399	E443G	probably benign	Het
Akp3	A	G	1: 87,125,631	Y102C	probably damaging	Het
Birc6	A	G	17: 74,579,531	N618S	probably benign	Het
Bpifc	A	G	10: 85,979,214	V296A	probably benign	Het
Cacna2d3	G	A	14: 28,969,318		probably benign	Het
Cacnb4	T	C	2: 52,474,954	N99S	probably damaging	Het
Cd38	A	G	5: 43,908,006	Y283C	probably damaging	Het
Celf4	T	A	18: 25,496,236	Q411L	probably damaging	Het
Cemip	A	T	7: 83,998,547	H108Q	probably damaging	Het
Col23a1	A	G	11: 51,561,893	E225G	unknown	Het
Dnah11	T	C	12: 118,060,310	E1902G	probably damaging	Het
Dst	A	G	1: 34,190,490	D2063G	probably damaging	Het
Fsip2	A	T	2: 82,992,840	I6306L	probably benign	Het
Furin	A	G	7: 80,391,090	S667P	possibly damaging	Het
Glmp	T	A	3: 88,325,832	S92R	probably benign	Het
Gm11563	C	G	11: 99,658,472	C152S	unknown	Het
Gm3486	A	G	14: 41,484,561	V185A	probably benign	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Hyal1	C	A	9: 107,579,170	A102E	probably damaging	Het
Invs	T	C	4: 48,421,785	C806R	probably benign	Het
L1td1	T	C	4: 98,733,696	V165A	probably benign	Het
Lama1	A	G	17: 67,813,866	T2666A		Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Lrrc8a	A	G	2: 30,256,227	Y351C	probably damaging	Het
Myh7b	T	C	2: 155,622,232	F551S	possibly damaging	Het
Myo19	A	G	11: 84,897,560	T333A	probably benign	Het
Nrp2	A	T	1: 62,760,788	N387I	probably damaging	Het
Olfr1040	A	G	2: 86,146,084	S217P	probably damaging	Het
Olfr117	A	G	17: 37,659,514	I273T	possibly damaging	Het
Pak7	A	G	2: 136,100,939	V427A	probably benign	Het
Pfas	G	A	11: 69,000,530	A247V	probably benign	Het
Psat1	T	A	19: 15,917,181	T115S	probably benign	Het
Psme4	T	A	11: 30,837,437	D1077E	probably benign	Het
Rabgap1l	A	G	1: 160,682,182	S442P	probably benign	Het
Ralgapa1	A	G	12: 55,776,191	M280T	possibly damaging	Het
Rb1cc1	A	T	1: 6,261,032	E394D	probably damaging	Het
Seh1l	T	C	18: 67,789,390	V271A	probably benign	Het
Sf3b1	A	T	1: 54,997,156	N919K	probably benign	Het
Sftpd	A	G	14: 41,174,492	S245P	possibly damaging	Het
Slc22a15	T	C	3: 101,924,114	E2G	probably damaging	Het
Spta1	A	G	1: 174,209,325	D1134G	possibly damaging	Het
Syna	A	G	5: 134,558,961	V378A	probably damaging	Het
Tchp	A	G	5: 114,709,350	K77E	possibly damaging	Het
Tescl	T	C	7: 24,333,531	N123S	probably benign	Het
Trio	C	T	15: 27,824,090	R1443Q	probably damaging	Het
Trrap	A	T	5: 144,790,855	Y462F	possibly damaging	Het
Vmn1r78	A	G	7: 12,152,905	T148A	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het

Other mutations in Oas2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00783:Oas2	APN	5	120738363	missense	probably damaging	1.00
IGL00784:Oas2	APN	5	120738363	missense	probably damaging	1.00
IGL01388:Oas2	APN	5	120748592	missense	probably damaging	1.00
IGL01643:Oas2	APN	5	120736187	splice site	probably benign
IGL01660:Oas2	APN	5	120741223	missense	probably benign	0.00
IGL02346:Oas2	APN	5	120736088	missense	probably benign	0.30
IGL02403:Oas2	APN	5	120748750	missense	possibly damaging	0.59
IGL03297:Oas2	APN	5	120735085	missense	possibly damaging	0.91
R0149:Oas2	UTSW	5	120738401	missense	probably damaging	0.99
R0344:Oas2	UTSW	5	120743087	missense	probably damaging	1.00
R0361:Oas2	UTSW	5	120738401	missense	probably damaging	0.99
R0387:Oas2	UTSW	5	120745672	splice site	probably benign
R0465:Oas2	UTSW	5	120735055	missense	probably damaging	0.99
R2100:Oas2	UTSW	5	120745675	critical splice donor site	probably null
R2324:Oas2	UTSW	5	120743274	missense	probably benign	0.43
R2496:Oas2	UTSW	5	120748617	missense	probably benign	0.00
R4357:Oas2	UTSW	5	120738669	critical splice donor site	probably null
R4466:Oas2	UTSW	5	120749602	missense	probably damaging	0.99
R4472:Oas2	UTSW	5	120741155	missense	possibly damaging	0.81
R4632:Oas2	UTSW	5	120733481	missense	probably benign	0.34
R4714:Oas2	UTSW	5	120733472	missense	probably damaging	1.00
R4824:Oas2	UTSW	5	120738346	missense	probably benign	0.32
R4872:Oas2	UTSW	5	120738534	missense	probably damaging	1.00
R5629:Oas2	UTSW	5	120738451	nonsense	probably null
R6351:Oas2	UTSW	5	120748538	missense	probably benign
R6463:Oas2	UTSW	5	120734981	missense	probably null	1.00
R6488:Oas2	UTSW	5	120738363	missense	probably damaging	1.00
R6787:Oas2	UTSW	5	120738798	missense	possibly damaging	0.77
R7353:Oas2	UTSW	5	120738522	missense	probably damaging	1.00
R7459:Oas2	UTSW	5	120749710	missense	unknown
R7634:Oas2	UTSW	5	120733228	missense	probably benign	0.18
R7639:Oas2	UTSW	5	120745686	nonsense	probably null
R7958:Oas2	UTSW	5	120748766	missense	probably benign	0.00
R7968:Oas2	UTSW	5	120738372	missense	probably benign	0.38
R8158:Oas2	UTSW	5	120749773	start codon destroyed	probably null

Predicted Primers

PCR Primer
(F):5'- CAAAGCCTGTGTCTCAGTTCAC -3'
(R):5'- AAGATCCTCTTTGGCTACATAGCAAG -3'

Sequencing Primer
(F):5'- AACCAACAACCAGCTTGGC -3'
(R):5'- CATAGCAAGTTGAATGCCATCTTGGG -3'

Posted On

2018-11-28