Incidental Mutation 'R6945:Syna'
ID 540838
Institutional Source Beutler Lab
Gene Symbol Syna
Ensembl Gene ENSMUSG00000085957
Gene Name syncytin a
Synonyms syncytin-A, Gm52
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6945 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 134558146-134560171 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 134558961 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 378 (V378A)
Ref Sequence ENSEMBL: ENSMUSP00000116437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000149604]
AlphaFold Q5G5D5
Predicted Effect probably damaging
Transcript: ENSMUST00000149604
AA Change: V378A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116437
Gene: ENSMUSG00000085957
AA Change: V378A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:TLV_coat 333 578 1.9e-59 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: Many different endogenous retrovirus families are expressed in normal placental tissue at high levels, suggesting that endogenous retroviruses are functionally important in reproduction. This gene is part of a mouse endogenous retrovirus provirus on chromosome 5 that has inactivating mutations in the gag and pol genes. This gene is the envelope glycoprotein gene which appears to have been selectively preserved. The gene's protein product plays a major role in placental development and trophoblast fusion. The protein has the characteristics of a typical retroviral envelope protein, including a cleavage site that separates the surface (SU) and transmembrane (TM) proteins which form a heterodimer. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between E11.5 and E14.5 associated with defective placental layrinth formation, impaired placental transport, and increased trophoblast cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,676,845 N246K probably benign Het
AA792892 C T 5: 94,383,631 H125Y possibly damaging Het
Abcc5 T A 16: 20,400,009 T208S probably benign Het
Acaa2 A G 18: 74,793,309 E112G probably benign Het
Adgrb1 A G 15: 74,550,024 N881S probably damaging Het
Adgre1 A G 17: 57,410,844 E314G probably benign Het
Adgre1 A G 17: 57,420,399 E443G probably benign Het
Akp3 A G 1: 87,125,631 Y102C probably damaging Het
Birc6 A G 17: 74,579,531 N618S probably benign Het
Bpifc A G 10: 85,979,214 V296A probably benign Het
Cacna2d3 G A 14: 28,969,318 probably benign Het
Cacnb4 T C 2: 52,474,954 N99S probably damaging Het
Cd38 A G 5: 43,908,006 Y283C probably damaging Het
Celf4 T A 18: 25,496,236 Q411L probably damaging Het
Cemip A T 7: 83,998,547 H108Q probably damaging Het
Col23a1 A G 11: 51,561,893 E225G unknown Het
Dnah11 T C 12: 118,060,310 E1902G probably damaging Het
Dst A G 1: 34,190,490 D2063G probably damaging Het
Fsip2 A T 2: 82,992,840 I6306L probably benign Het
Furin A G 7: 80,391,090 S667P possibly damaging Het
Glmp T A 3: 88,325,832 S92R probably benign Het
Gm11563 C G 11: 99,658,472 C152S unknown Het
Gm3486 A G 14: 41,484,561 V185A probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Hyal1 C A 9: 107,579,170 A102E probably damaging Het
Invs T C 4: 48,421,785 C806R probably benign Het
L1td1 T C 4: 98,733,696 V165A probably benign Het
Lama1 A G 17: 67,813,866 T2666A Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc8a A G 2: 30,256,227 Y351C probably damaging Het
Myh7b T C 2: 155,622,232 F551S possibly damaging Het
Myo19 A G 11: 84,897,560 T333A probably benign Het
Nrp2 A T 1: 62,760,788 N387I probably damaging Het
Oas2 T C 5: 120,736,139 D543G probably benign Het
Olfr1040 A G 2: 86,146,084 S217P probably damaging Het
Olfr117 A G 17: 37,659,514 I273T possibly damaging Het
Pak7 A G 2: 136,100,939 V427A probably benign Het
Pfas G A 11: 69,000,530 A247V probably benign Het
Psat1 T A 19: 15,917,181 T115S probably benign Het
Psme4 T A 11: 30,837,437 D1077E probably benign Het
Rabgap1l A G 1: 160,682,182 S442P probably benign Het
Ralgapa1 A G 12: 55,776,191 M280T possibly damaging Het
Rb1cc1 A T 1: 6,261,032 E394D probably damaging Het
Seh1l T C 18: 67,789,390 V271A probably benign Het
Sf3b1 A T 1: 54,997,156 N919K probably benign Het
Sftpd A G 14: 41,174,492 S245P possibly damaging Het
Slc22a15 T C 3: 101,924,114 E2G probably damaging Het
Spta1 A G 1: 174,209,325 D1134G possibly damaging Het
Tchp A G 5: 114,709,350 K77E possibly damaging Het
Tescl T C 7: 24,333,531 N123S probably benign Het
Trio C T 15: 27,824,090 R1443Q probably damaging Het
Trrap A T 5: 144,790,855 Y462F possibly damaging Het
Vmn1r78 A G 7: 12,152,905 T148A probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Syna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Syna APN 5 134559717 missense possibly damaging 0.94
IGL01128:Syna APN 5 134559480 missense probably damaging 0.99
IGL03183:Syna APN 5 134558290 missense probably benign 0.03
R0051:Syna UTSW 5 134559543 missense probably damaging 1.00
R0051:Syna UTSW 5 134559543 missense probably damaging 0.99
R0137:Syna UTSW 5 134559460 missense possibly damaging 0.93
R0920:Syna UTSW 5 134559102 missense probably benign 0.12
R1525:Syna UTSW 5 134559258 missense probably benign
R1801:Syna UTSW 5 134560089 missense probably benign 0.02
R1813:Syna UTSW 5 134559152 missense probably benign 0.06
R1866:Syna UTSW 5 134559915 missense probably damaging 1.00
R1887:Syna UTSW 5 134559252 missense probably benign
R1896:Syna UTSW 5 134559152 missense probably benign 0.06
R2139:Syna UTSW 5 134559252 nonsense probably null
R3896:Syna UTSW 5 134558311 nonsense probably null
R4674:Syna UTSW 5 134558355 missense probably damaging 0.99
R4730:Syna UTSW 5 134558586 missense probably damaging 1.00
R5124:Syna UTSW 5 134559570 missense possibly damaging 0.65
R5482:Syna UTSW 5 134559174 missense possibly damaging 0.94
R6130:Syna UTSW 5 134558268 missense possibly damaging 0.72
R6196:Syna UTSW 5 134559612 missense probably benign 0.14
R6243:Syna UTSW 5 134560114 start gained probably benign
R7999:Syna UTSW 5 134559192 missense probably benign
R8320:Syna UTSW 5 134559720 missense possibly damaging 0.86
R8783:Syna UTSW 5 134559869 missense probably benign 0.01
R8784:Syna UTSW 5 134559869 missense probably benign 0.01
R8785:Syna UTSW 5 134559869 missense probably benign 0.01
R8786:Syna UTSW 5 134559869 missense probably benign 0.01
R8787:Syna UTSW 5 134559869 missense probably benign 0.01
X0022:Syna UTSW 5 134559573 missense probably benign 0.01
Z1088:Syna UTSW 5 134558529 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGTTGAGGTGGTGATACCCG -3'
(R):5'- TTCAGTACCAGCCCCTCATG -3'

Sequencing Primer
(F):5'- GTGATACCCGCGATGCCTAAC -3'
(R):5'- CTCTCTGGACAATATTCAATCTGGG -3'
Posted On 2018-11-28