Incidental Mutation 'R6945:Hyal1'
ID540845
Institutional Source Beutler Lab
Gene Symbol Hyal1
Ensembl Gene ENSMUSG00000010051
Gene Namehyaluronoglucosaminidase 1
SynonymsHyal-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6945 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location107576927-107581710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107579170 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 102 (A102E)
Ref Sequence ENSEMBL: ENSMUSP00000122601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010195] [ENSMUST00000040059] [ENSMUST00000093785] [ENSMUST00000112387] [ENSMUST00000122985] [ENSMUST00000123005] [ENSMUST00000127380] [ENSMUST00000130053] [ENSMUST00000139274] [ENSMUST00000139581] [ENSMUST00000144392] [ENSMUST00000148440] [ENSMUST00000149638]
Predicted Effect probably damaging
Transcript: ENSMUST00000010195
AA Change: A382E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000010195
Gene: ENSMUSG00000010051
AA Change: A382E

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 53 383 5.7e-134 PFAM
EGF 385 458 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040059
SMART Domains Protein: ENSMUSP00000042667
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 354 4.8e-122 PFAM
EGF 356 408 2.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093785
SMART Domains Protein: ENSMUSP00000091300
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 4.95e-7 PROSPERO
internal_repeat_1 40 99 4.95e-7 PROSPERO
Pfam:Acetyltransf_1 144 217 2.1e-12 PFAM
Pfam:Acetyltransf_7 147 218 9.5e-9 PFAM
low complexity region 242 253 N/A INTRINSIC
low complexity region 261 296 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112387
AA Change: A382E

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108006
Gene: ENSMUSG00000010051
AA Change: A382E

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 384 7e-153 PFAM
Blast:EGF 385 454 1e-42 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000122985
SMART Domains Protein: ENSMUSP00000122807
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123005
AA Change: A102E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122601
Gene: ENSMUSG00000010051
AA Change: A102E

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 1 104 6.8e-37 PFAM
EGF 105 178 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127380
SMART Domains Protein: ENSMUSP00000116378
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130053
SMART Domains Protein: ENSMUSP00000114490
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139274
SMART Domains Protein: ENSMUSP00000138933
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 45 105 7.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139581
SMART Domains Protein: ENSMUSP00000122321
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000144392
AA Change: A352E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120599
Gene: ENSMUSG00000010051
AA Change: A352E

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 330 1.8e-128 PFAM
Pfam:Glyco_hydro_56 325 354 2.6e-8 PFAM
EGF 355 428 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148440
SMART Domains Protein: ENSMUSP00000119499
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 21 355 2.6e-127 PFAM
EGF 356 408 2.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149638
SMART Domains Protein: ENSMUSP00000139004
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 45 105 7.4e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display a progressive osteoarthritis associated with bony outgrowths, early loss of articular cartilage proteoglycans and accumulation of hyaluronan (HA) in the cartilage of knee joints, but show no signs of non-skeletal tissue GAG accumulation or increased serum HA levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,676,845 N246K probably benign Het
AA792892 C T 5: 94,383,631 H125Y possibly damaging Het
Abcc5 T A 16: 20,400,009 T208S probably benign Het
Acaa2 A G 18: 74,793,309 E112G probably benign Het
Adgrb1 A G 15: 74,550,024 N881S probably damaging Het
Adgre1 A G 17: 57,410,844 E314G probably benign Het
Adgre1 A G 17: 57,420,399 E443G probably benign Het
Akp3 A G 1: 87,125,631 Y102C probably damaging Het
Birc6 A G 17: 74,579,531 N618S probably benign Het
Bpifc A G 10: 85,979,214 V296A probably benign Het
Cacna2d3 G A 14: 28,969,318 probably benign Het
Cacnb4 T C 2: 52,474,954 N99S probably damaging Het
Cd38 A G 5: 43,908,006 Y283C probably damaging Het
Celf4 T A 18: 25,496,236 Q411L probably damaging Het
Cemip A T 7: 83,998,547 H108Q probably damaging Het
Col23a1 A G 11: 51,561,893 E225G unknown Het
Dnah11 T C 12: 118,060,310 E1902G probably damaging Het
Dst A G 1: 34,190,490 D2063G probably damaging Het
Fsip2 A T 2: 82,992,840 I6306L probably benign Het
Furin A G 7: 80,391,090 S667P possibly damaging Het
Glmp T A 3: 88,325,832 S92R probably benign Het
Gm11563 C G 11: 99,658,472 C152S unknown Het
Gm3486 A G 14: 41,484,561 V185A probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Invs T C 4: 48,421,785 C806R probably benign Het
L1td1 T C 4: 98,733,696 V165A probably benign Het
Lama1 A G 17: 67,813,866 T2666A Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc8a A G 2: 30,256,227 Y351C probably damaging Het
Myh7b T C 2: 155,622,232 F551S possibly damaging Het
Myo19 A G 11: 84,897,560 T333A probably benign Het
Nrp2 A T 1: 62,760,788 N387I probably damaging Het
Oas2 T C 5: 120,736,139 D543G probably benign Het
Olfr1040 A G 2: 86,146,084 S217P probably damaging Het
Olfr117 A G 17: 37,659,514 I273T possibly damaging Het
Pak7 A G 2: 136,100,939 V427A probably benign Het
Pfas G A 11: 69,000,530 A247V probably benign Het
Psat1 T A 19: 15,917,181 T115S probably benign Het
Psme4 T A 11: 30,837,437 D1077E probably benign Het
Rabgap1l A G 1: 160,682,182 S442P probably benign Het
Ralgapa1 A G 12: 55,776,191 M280T possibly damaging Het
Rb1cc1 A T 1: 6,261,032 E394D probably damaging Het
Seh1l T C 18: 67,789,390 V271A probably benign Het
Sf3b1 A T 1: 54,997,156 N919K probably benign Het
Sftpd A G 14: 41,174,492 S245P possibly damaging Het
Slc22a15 T C 3: 101,924,114 E2G probably damaging Het
Spta1 A G 1: 174,209,325 D1134G possibly damaging Het
Syna A G 5: 134,558,961 V378A probably damaging Het
Tchp A G 5: 114,709,350 K77E possibly damaging Het
Tescl T C 7: 24,333,531 N123S probably benign Het
Trio C T 15: 27,824,090 R1443Q probably damaging Het
Trrap A T 5: 144,790,855 Y462F possibly damaging Het
Vmn1r78 A G 7: 12,152,905 T148A probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Hyal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01768:Hyal1 APN 9 107579139 missense probably damaging 1.00
IGL02265:Hyal1 APN 9 107577908 missense probably benign 0.03
PIT4377001:Hyal1 UTSW 9 107579269 missense probably damaging 1.00
R0043:Hyal1 UTSW 9 107579320 missense probably benign 0.15
R0727:Hyal1 UTSW 9 107578402 missense possibly damaging 0.71
R1497:Hyal1 UTSW 9 107577995 unclassified probably null
R1499:Hyal1 UTSW 9 107577892 missense probably damaging 1.00
R3903:Hyal1 UTSW 9 107578972 critical splice donor site probably null
R4662:Hyal1 UTSW 9 107579221 missense probably damaging 1.00
R4977:Hyal1 UTSW 9 107578954 missense probably benign 0.19
R5122:Hyal1 UTSW 9 107578069 missense probably benign 0.00
R5781:Hyal1 UTSW 9 107577667 missense probably damaging 1.00
R6142:Hyal1 UTSW 9 107579374 missense probably benign 0.00
R6651:Hyal1 UTSW 9 107579371 missense probably damaging 1.00
R7335:Hyal1 UTSW 9 107579160 missense probably benign 0.27
R7651:Hyal1 UTSW 9 107578370 missense probably damaging 1.00
R7810:Hyal1 UTSW 9 107578429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCAAGGTAAGTGGAGGCCTG -3'
(R):5'- CGGCACCTGAATTTCATAGC -3'

Sequencing Primer
(F):5'- GCCTGGGAGTAGGGCAG -3'
(R):5'- GGCACCTGAATTTCATAGCCATCTG -3'
Posted On2018-11-28