Mutagenetix > Incidental Mutations

Incidental Mutation 'R6945:Pfas'

540849

Institutional Source

Beutler Lab

Gene Symbol

Pfas

Ensembl Gene

ENSMUSG00000020899

Gene Name

phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)

Synonyms

4432409B16Rik, Sofa

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6945 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68985697-69008460 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 69000530 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 247 (A247V)

Ref Sequence

ENSEMBL: ENSMUSP00000021282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021282]

AlphaFold

Q5SUR0

Predicted Effect

probably benign
Transcript: ENSMUST00000021282
AA Change: A247V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: A247V

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	444	603	1.7e-21	PFAM
low complexity region	615	632	N/A	INTRINSIC
low complexity region	786	798	N/A	INTRINSIC
Pfam:AIRS_C	853	988	3e-11	PFAM
GATase_5	1061	1332	8.38e-133	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

96% (51/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	A	C	5: 109,676,845	N246K	probably benign	Het
AA792892	C	T	5: 94,383,631	H125Y	possibly damaging	Het
Abcc5	T	A	16: 20,400,009	T208S	probably benign	Het
Acaa2	A	G	18: 74,793,309	E112G	probably benign	Het
Adgrb1	A	G	15: 74,550,024	N881S	probably damaging	Het
Adgre1	A	G	17: 57,410,844	E314G	probably benign	Het
Adgre1	A	G	17: 57,420,399	E443G	probably benign	Het
Akp3	A	G	1: 87,125,631	Y102C	probably damaging	Het
Birc6	A	G	17: 74,579,531	N618S	probably benign	Het
Bpifc	A	G	10: 85,979,214	V296A	probably benign	Het
Cacna2d3	G	A	14: 28,969,318		probably benign	Het
Cacnb4	T	C	2: 52,474,954	N99S	probably damaging	Het
Cd38	A	G	5: 43,908,006	Y283C	probably damaging	Het
Celf4	T	A	18: 25,496,236	Q411L	probably damaging	Het
Cemip	A	T	7: 83,998,547	H108Q	probably damaging	Het
Col23a1	A	G	11: 51,561,893	E225G	unknown	Het
Dnah11	T	C	12: 118,060,310	E1902G	probably damaging	Het
Dst	A	G	1: 34,190,490	D2063G	probably damaging	Het
Fsip2	A	T	2: 82,992,840	I6306L	probably benign	Het
Furin	A	G	7: 80,391,090	S667P	possibly damaging	Het
Glmp	T	A	3: 88,325,832	S92R	probably benign	Het
Gm11563	C	G	11: 99,658,472	C152S	unknown	Het
Gm3486	A	G	14: 41,484,561	V185A	probably benign	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Hyal1	C	A	9: 107,579,170	A102E	probably damaging	Het
Invs	T	C	4: 48,421,785	C806R	probably benign	Het
L1td1	T	C	4: 98,733,696	V165A	probably benign	Het
Lama1	A	G	17: 67,813,866	T2666A		Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Lrrc8a	A	G	2: 30,256,227	Y351C	probably damaging	Het
Myh7b	T	C	2: 155,622,232	F551S	possibly damaging	Het
Myo19	A	G	11: 84,897,560	T333A	probably benign	Het
Nrp2	A	T	1: 62,760,788	N387I	probably damaging	Het
Oas2	T	C	5: 120,736,139	D543G	probably benign	Het
Olfr1040	A	G	2: 86,146,084	S217P	probably damaging	Het
Olfr117	A	G	17: 37,659,514	I273T	possibly damaging	Het
Pak7	A	G	2: 136,100,939	V427A	probably benign	Het
Psat1	T	A	19: 15,917,181	T115S	probably benign	Het
Psme4	T	A	11: 30,837,437	D1077E	probably benign	Het
Rabgap1l	A	G	1: 160,682,182	S442P	probably benign	Het
Ralgapa1	A	G	12: 55,776,191	M280T	possibly damaging	Het
Rb1cc1	A	T	1: 6,261,032	E394D	probably damaging	Het
Seh1l	T	C	18: 67,789,390	V271A	probably benign	Het
Sf3b1	A	T	1: 54,997,156	N919K	probably benign	Het
Sftpd	A	G	14: 41,174,492	S245P	possibly damaging	Het
Slc22a15	T	C	3: 101,924,114	E2G	probably damaging	Het
Spta1	A	G	1: 174,209,325	D1134G	possibly damaging	Het
Syna	A	G	5: 134,558,961	V378A	probably damaging	Het
Tchp	A	G	5: 114,709,350	K77E	possibly damaging	Het
Tescl	T	C	7: 24,333,531	N123S	probably benign	Het
Trio	C	T	15: 27,824,090	R1443Q	probably damaging	Het
Trrap	A	T	5: 144,790,855	Y462F	possibly damaging	Het
Vmn1r78	A	G	7: 12,152,905	T148A	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het

Other mutations in Pfas

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Pfas	APN	11	69003814	nonsense	probably null
IGL01287:Pfas	APN	11	69001260	missense	probably benign	0.09
IGL01712:Pfas	APN	11	68991060	missense	probably benign	0.34
IGL02019:Pfas	APN	11	68993463	unclassified	probably benign
IGL02053:Pfas	APN	11	68992953	missense	probably damaging	1.00
IGL02718:Pfas	APN	11	69000145	splice site	probably benign
IGL02801:Pfas	APN	11	68988277	unclassified	probably benign
Surf	UTSW	11	68988021	missense	probably damaging	1.00
PIT4812001:Pfas	UTSW	11	68990036	missense
R0037:Pfas	UTSW	11	69000036	missense	probably damaging	1.00
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0408:Pfas	UTSW	11	69001105	critical splice donor site	probably null
R0532:Pfas	UTSW	11	69002629	splice site	probably benign
R0707:Pfas	UTSW	11	68998037	missense	probably benign	0.00
R0783:Pfas	UTSW	11	69000521	missense	probably damaging	1.00
R0946:Pfas	UTSW	11	68993295	critical splice donor site	probably null
R0946:Pfas	UTSW	11	68990747	splice site	probably null
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1507:Pfas	UTSW	11	68990034	missense	probably benign	0.06
R1699:Pfas	UTSW	11	68998046	critical splice acceptor site	probably null
R1870:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1871:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1959:Pfas	UTSW	11	68994284	missense	probably damaging	1.00
R2026:Pfas	UTSW	11	68993957	missense	probably damaging	1.00
R2180:Pfas	UTSW	11	68992187	missense	possibly damaging	0.92
R3808:Pfas	UTSW	11	68989953	intron	probably benign
R3809:Pfas	UTSW	11	68989953	intron	probably benign
R3872:Pfas	UTSW	11	69000263	missense	probably damaging	1.00
R3906:Pfas	UTSW	11	68988286	unclassified	probably benign
R4092:Pfas	UTSW	11	68993949	missense	probably benign
R4437:Pfas	UTSW	11	68988417	missense	probably damaging	1.00
R4599:Pfas	UTSW	11	68991069	missense	probably benign	0.15
R4763:Pfas	UTSW	11	68990194	missense	possibly damaging	0.81
R5116:Pfas	UTSW	11	68990990	intron	probably benign
R5310:Pfas	UTSW	11	68988021	missense	probably damaging	1.00
R5328:Pfas	UTSW	11	68988592	missense	probably damaging	1.00
R5351:Pfas	UTSW	11	68991391	missense	probably damaging	1.00
R5427:Pfas	UTSW	11	69001153	missense	possibly damaging	0.90
R5533:Pfas	UTSW	11	68991470	missense	probably benign	0.02
R5602:Pfas	UTSW	11	68991045	missense	probably benign	0.05
R5637:Pfas	UTSW	11	68993323	missense	probably damaging	1.00
R5645:Pfas	UTSW	11	68991132	missense	probably damaging	1.00
R6149:Pfas	UTSW	11	68991945	missense	probably benign	0.07
R6295:Pfas	UTSW	11	68997999	missense	probably benign	0.36
R6305:Pfas	UTSW	11	69001197	missense	possibly damaging	0.51
R6387:Pfas	UTSW	11	69000465	missense	probably damaging	1.00
R6425:Pfas	UTSW	11	68991071	missense	probably benign	0.17
R6523:Pfas	UTSW	11	68990457	missense	probably benign
R6914:Pfas	UTSW	11	68992181	missense	probably benign	0.01
R6915:Pfas	UTSW	11	68992181	missense	probably benign	0.01
R6957:Pfas	UTSW	11	68993883	missense	probably benign	0.14
R7025:Pfas	UTSW	11	68990760	missense	probably benign	0.01
R7257:Pfas	UTSW	11	68992959	missense	probably damaging	1.00
R7386:Pfas	UTSW	11	69003774	missense	probably benign
R7424:Pfas	UTSW	11	69000092	missense	probably damaging	1.00
R7459:Pfas	UTSW	11	68988655	missense
R7593:Pfas	UTSW	11	68991095	missense
R7731:Pfas	UTSW	11	69000045	missense	probably damaging	1.00
R8103:Pfas	UTSW	11	68992293	missense	probably damaging	0.98
R8248:Pfas	UTSW	11	69000263	missense	probably damaging	1.00
R8804:Pfas	UTSW	11	68991082	missense
R8853:Pfas	UTSW	11	68992918	missense	probably damaging	1.00
R9032:Pfas	UTSW	11	68988595	missense
R9050:Pfas	UTSW	11	68991741	missense	probably benign	0.01
R9283:Pfas	UTSW	11	68993882	missense	probably damaging	1.00
Z1176:Pfas	UTSW	11	68990070	missense
Z1176:Pfas	UTSW	11	69002487	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	68990225	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	69002493	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCCTGGATTGCACTGTAGACAC -3'
(R):5'- GGAGTCTACTGCTAAACCTTGC -3'

Sequencing Primer
(F):5'- GTAGACACAGTCACTCTACACCCTG -3'
(R):5'- TTCTGGACAAGCCGCAGTG -3'

Posted On

2018-11-28