Incidental Mutation 'R6945:Vmn2r111'
ID 540861
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Name vomeronasal 2, receptor 111
Synonyms EG210876
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R6945 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 22547941-22573273 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22559051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 549 (N549S)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
AlphaFold K7N674
Predicted Effect possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,676,845 N246K probably benign Het
AA792892 C T 5: 94,383,631 H125Y possibly damaging Het
Abcc5 T A 16: 20,400,009 T208S probably benign Het
Acaa2 A G 18: 74,793,309 E112G probably benign Het
Adgrb1 A G 15: 74,550,024 N881S probably damaging Het
Adgre1 A G 17: 57,410,844 E314G probably benign Het
Adgre1 A G 17: 57,420,399 E443G probably benign Het
Akp3 A G 1: 87,125,631 Y102C probably damaging Het
Birc6 A G 17: 74,579,531 N618S probably benign Het
Bpifc A G 10: 85,979,214 V296A probably benign Het
Cacna2d3 G A 14: 28,969,318 probably benign Het
Cacnb4 T C 2: 52,474,954 N99S probably damaging Het
Cd38 A G 5: 43,908,006 Y283C probably damaging Het
Celf4 T A 18: 25,496,236 Q411L probably damaging Het
Cemip A T 7: 83,998,547 H108Q probably damaging Het
Col23a1 A G 11: 51,561,893 E225G unknown Het
Dnah11 T C 12: 118,060,310 E1902G probably damaging Het
Dst A G 1: 34,190,490 D2063G probably damaging Het
Fsip2 A T 2: 82,992,840 I6306L probably benign Het
Furin A G 7: 80,391,090 S667P possibly damaging Het
Glmp T A 3: 88,325,832 S92R probably benign Het
Gm11563 C G 11: 99,658,472 C152S unknown Het
Gm3486 A G 14: 41,484,561 V185A probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Hyal1 C A 9: 107,579,170 A102E probably damaging Het
Invs T C 4: 48,421,785 C806R probably benign Het
L1td1 T C 4: 98,733,696 V165A probably benign Het
Lama1 A G 17: 67,813,866 T2666A Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc8a A G 2: 30,256,227 Y351C probably damaging Het
Myh7b T C 2: 155,622,232 F551S possibly damaging Het
Myo19 A G 11: 84,897,560 T333A probably benign Het
Nrp2 A T 1: 62,760,788 N387I probably damaging Het
Oas2 T C 5: 120,736,139 D543G probably benign Het
Olfr1040 A G 2: 86,146,084 S217P probably damaging Het
Olfr117 A G 17: 37,659,514 I273T possibly damaging Het
Pak7 A G 2: 136,100,939 V427A probably benign Het
Pfas G A 11: 69,000,530 A247V probably benign Het
Psat1 T A 19: 15,917,181 T115S probably benign Het
Psme4 T A 11: 30,837,437 D1077E probably benign Het
Rabgap1l A G 1: 160,682,182 S442P probably benign Het
Ralgapa1 A G 12: 55,776,191 M280T possibly damaging Het
Rb1cc1 A T 1: 6,261,032 E394D probably damaging Het
Seh1l T C 18: 67,789,390 V271A probably benign Het
Sf3b1 A T 1: 54,997,156 N919K probably benign Het
Sftpd A G 14: 41,174,492 S245P possibly damaging Het
Slc22a15 T C 3: 101,924,114 E2G probably damaging Het
Spta1 A G 1: 174,209,325 D1134G possibly damaging Het
Syna A G 5: 134,558,961 V378A probably damaging Het
Tchp A G 5: 114,709,350 K77E possibly damaging Het
Tescl T C 7: 24,333,531 N123S probably benign Het
Trio C T 15: 27,824,090 R1443Q probably damaging Het
Trrap A T 5: 144,790,855 Y462F possibly damaging Het
Vmn1r78 A G 7: 12,152,905 T148A probably benign Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22548753 missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22568984 missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22569016 missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22571985 nonsense probably null
IGL01465:Vmn2r111 APN 17 22548737 missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22548572 missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22571392 missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22569073 splice site probably benign
IGL01962:Vmn2r111 APN 17 22548284 missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22570773 missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22568856 missense probably benign
IGL02519:Vmn2r111 APN 17 22548339 missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22571050 missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22573224 missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22559042 critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22571245 missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22570858 missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22548009 missense probably benign
R0064:Vmn2r111 UTSW 17 22572072 missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22573121 missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22571116 missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22571399 missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22548060 missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22548081 missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22548414 missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22559062 missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22573104 missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22559170 splice site probably benign
R3700:Vmn2r111 UTSW 17 22571161 nonsense probably null
R3782:Vmn2r111 UTSW 17 22571320 missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22559115 missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22573178 missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22548656 missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22548041 missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22571143 missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22571020 missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22548102 nonsense probably null
R5398:Vmn2r111 UTSW 17 22573271 start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22548489 missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22548257 missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22548815 missense probably benign 0.00
R6149:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6207:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22573089 missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22571908 missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22548602 missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22571245 missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22548184 missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22548714 missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22571086 missense possibly damaging 0.93
R7514:Vmn2r111 UTSW 17 22548399 missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22570733 missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22573102 missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22571488 missense probably benign 0.12
R8171:Vmn2r111 UTSW 17 22573092 missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8411:Vmn2r111 UTSW 17 22548581 missense probably benign 0.03
R8539:Vmn2r111 UTSW 17 22571293 missense probably benign 0.23
R8540:Vmn2r111 UTSW 17 22559042 critical splice donor site probably null
R8540:Vmn2r111 UTSW 17 22559043 missense probably damaging 1.00
R8557:Vmn2r111 UTSW 17 22571929 nonsense probably null
R8720:Vmn2r111 UTSW 17 22573213 missense possibly damaging 0.88
R8729:Vmn2r111 UTSW 17 22548258 missense probably damaging 1.00
R8843:Vmn2r111 UTSW 17 22548030 missense probably benign 0.00
R9184:Vmn2r111 UTSW 17 22571841 missense probably benign
R9374:Vmn2r111 UTSW 17 22568878 missense probably benign 0.17
X0026:Vmn2r111 UTSW 17 22548695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAAGGTGTAAAAGATGCAGCC -3'
(R):5'- TCAAGGAGTTGGGAAACAATTCAAC -3'

Sequencing Primer
(F):5'- GGTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'
Posted On 2018-11-28