Mutagenetix > Incidental Mutation

Incidental Mutation 'R6945:Adgre1'

540863

Institutional Source

Beutler Lab

Gene Symbol

Adgre1

Ensembl Gene

ENSMUSG00000004730

Gene Name

adhesion G protein-coupled receptor E1

Synonyms

Emr1, EGF-TM7, F4/80, DD7A5-7, TM7LN3, Ly71

MMRRC Submission

045059-MU

Accession Numbers

Ncbi RefSeq: NM_010130.4 ;MGI:106912

Essential gene?

Possibly non essential (E-score: 0.371) question?

Stock #

R6945 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57358686-57483529 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57410844 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 314 (E314G)

Ref Sequence

ENSEMBL: ENSMUSP00000083971 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]

AlphaFold

Q61549

Predicted Effect

probably benign
Transcript: ENSMUST00000004850
AA Change: E314G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: E314G

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
EGF	35	80	1.43e-1	SMART
EGF_CA	81	122	3.59e-7	SMART
EGF_CA	133	172	4.56e-9	SMART
EGF_CA	173	221	1.29e-8	SMART
EGF_CA	222	271	2.31e-10	SMART
EGF_CA	272	318	1.06e-9	SMART
EGF_CA	319	367	1.18e-7	SMART
GPS	591	641	2.57e-19	SMART
Pfam:7tm_2	644	885	2.1e-63	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000086763
AA Change: E314G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: E314G

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
EGF	35	80	1.43e-1	SMART
EGF_CA	81	122	3.59e-7	SMART
EGF_CA	133	172	4.56e-9	SMART
EGF_CA	173	221	1.29e-8	SMART
EGF_CA	222	271	2.31e-10	SMART
EGF_CA	272	318	1.06e-9	SMART
EGF_CA	319	367	1.18e-7	SMART
GPS	591	641	2.57e-19	SMART
Pfam:7tm_2	644	885	2.1e-63	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

96% (51/53)

MGI Phenotype

Strain: 3582333
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	A	C	5: 109,676,845	N246K	probably benign	Het
AA792892	C	T	5: 94,383,631	H125Y	possibly damaging	Het
Abcc5	T	A	16: 20,400,009	T208S	probably benign	Het
Acaa2	A	G	18: 74,793,309	E112G	probably benign	Het
Adgrb1	A	G	15: 74,550,024	N881S	probably damaging	Het
Akp3	A	G	1: 87,125,631	Y102C	probably damaging	Het
Birc6	A	G	17: 74,579,531	N618S	probably benign	Het
Bpifc	A	G	10: 85,979,214	V296A	probably benign	Het
Cacna2d3	G	A	14: 28,969,318		probably benign	Het
Cacnb4	T	C	2: 52,474,954	N99S	probably damaging	Het
Cd38	A	G	5: 43,908,006	Y283C	probably damaging	Het
Celf4	T	A	18: 25,496,236	Q411L	probably damaging	Het
Cemip	A	T	7: 83,998,547	H108Q	probably damaging	Het
Col23a1	A	G	11: 51,561,893	E225G	unknown	Het
Dnah11	T	C	12: 118,060,310	E1902G	probably damaging	Het
Dst	A	G	1: 34,190,490	D2063G	probably damaging	Het
Fsip2	A	T	2: 82,992,840	I6306L	probably benign	Het
Furin	A	G	7: 80,391,090	S667P	possibly damaging	Het
Glmp	T	A	3: 88,325,832	S92R	probably benign	Het
Gm11563	C	G	11: 99,658,472	C152S	unknown	Het
Gm3486	A	G	14: 41,484,561	V185A	probably benign	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Hyal1	C	A	9: 107,579,170	A102E	probably damaging	Het
Invs	T	C	4: 48,421,785	C806R	probably benign	Het
L1td1	T	C	4: 98,733,696	V165A	probably benign	Het
Lama1	A	G	17: 67,813,866	T2666A		Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Lrrc8a	A	G	2: 30,256,227	Y351C	probably damaging	Het
Myh7b	T	C	2: 155,622,232	F551S	possibly damaging	Het
Myo19	A	G	11: 84,897,560	T333A	probably benign	Het
Nrp2	A	T	1: 62,760,788	N387I	probably damaging	Het
Oas2	T	C	5: 120,736,139	D543G	probably benign	Het
Olfr1040	A	G	2: 86,146,084	S217P	probably damaging	Het
Olfr117	A	G	17: 37,659,514	I273T	possibly damaging	Het
Pak7	A	G	2: 136,100,939	V427A	probably benign	Het
Pfas	G	A	11: 69,000,530	A247V	probably benign	Het
Psat1	T	A	19: 15,917,181	T115S	probably benign	Het
Psme4	T	A	11: 30,837,437	D1077E	probably benign	Het
Rabgap1l	A	G	1: 160,682,182	S442P	probably benign	Het
Ralgapa1	A	G	12: 55,776,191	M280T	possibly damaging	Het
Rb1cc1	A	T	1: 6,261,032	E394D	probably damaging	Het
Seh1l	T	C	18: 67,789,390	V271A	probably benign	Het
Sf3b1	A	T	1: 54,997,156	N919K	probably benign	Het
Sftpd	A	G	14: 41,174,492	S245P	possibly damaging	Het
Slc22a15	T	C	3: 101,924,114	E2G	probably damaging	Het
Spta1	A	G	1: 174,209,325	D1134G	possibly damaging	Het
Syna	A	G	5: 134,558,961	V378A	probably damaging	Het
Tchp	A	G	5: 114,709,350	K77E	possibly damaging	Het
Tescl	T	C	7: 24,333,531	N123S	probably benign	Het
Trio	C	T	15: 27,824,090	R1443Q	probably damaging	Het
Trrap	A	T	5: 144,790,855	Y462F	possibly damaging	Het
Vmn1r78	A	G	7: 12,152,905	T148A	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het

Other mutations in Adgre1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Adgre1	APN	17	57450055	missense	probably benign	0.00
IGL00966:Adgre1	APN	17	57419335	missense	probably benign	0.04
IGL01680:Adgre1	APN	17	57402620	missense	unknown
IGL01724:Adgre1	APN	17	57444064	nonsense	probably null
IGL02172:Adgre1	APN	17	57478879	missense	probably damaging	1.00
IGL02260:Adgre1	APN	17	57447891	missense	probably benign	0.01
IGL02272:Adgre1	APN	17	57450021	nonsense	probably null
IGL02336:Adgre1	APN	17	57411024	nonsense	probably null
IGL02346:Adgre1	APN	17	57443919	missense	probably benign	0.15
IGL02398:Adgre1	APN	17	57402824	nonsense	probably null
IGL02618:Adgre1	APN	17	57444021	missense	possibly damaging	0.66
IGL02690:Adgre1	APN	17	57480921	missense	probably damaging	1.00
IGL02936:Adgre1	APN	17	57478833	missense	probably benign	0.26
IGL03112:Adgre1	APN	17	57448029	splice site	probably null
IGL03350:Adgre1	APN	17	57401908	missense	probably benign	0.16
F480	UTSW	17	57444063	missense	probably damaging	1.00
lomax	UTSW	17	57402811	missense	unknown
Onion	UTSW	17	57402841	nonsense	probably null
Scallion	UTSW	17	57401977	missense	possibly damaging	0.90
R0049:Adgre1	UTSW	17	57402841	nonsense	probably null
R0153:Adgre1	UTSW	17	57443939	missense	possibly damaging	0.92
R0277:Adgre1	UTSW	17	57444060	missense	probably benign	0.00
R0278:Adgre1	UTSW	17	57447872	missense	probably benign	0.07
R0323:Adgre1	UTSW	17	57444060	missense	probably benign	0.00
R0389:Adgre1	UTSW	17	57406839	missense	possibly damaging	0.80
R0492:Adgre1	UTSW	17	57402742	missense	unknown
R0621:Adgre1	UTSW	17	57441359	missense	probably damaging	0.98
R0647:Adgre1	UTSW	17	57411003	missense	probably damaging	1.00
R1310:Adgre1	UTSW	17	57447936	missense	probably benign	0.00
R1601:Adgre1	UTSW	17	57441353	missense	probably benign	0.01
R1689:Adgre1	UTSW	17	57449921	missense	probably benign	0.31
R1708:Adgre1	UTSW	17	57401974	missense	possibly damaging	0.93
R1796:Adgre1	UTSW	17	57441350	missense	probably benign	0.43
R1839:Adgre1	UTSW	17	57441299	missense	probably benign	0.00
R1860:Adgre1	UTSW	17	57441363	missense	probably benign	0.00
R2165:Adgre1	UTSW	17	57419338	missense	probably damaging	0.97
R2219:Adgre1	UTSW	17	57401912	missense	possibly damaging	0.92
R2519:Adgre1	UTSW	17	57410956	missense	probably damaging	1.00
R3874:Adgre1	UTSW	17	57401925	missense	probably benign	0.08
R3911:Adgre1	UTSW	17	57447860	missense	probably damaging	1.00
R4190:Adgre1	UTSW	17	57402811	missense	unknown
R4439:Adgre1	UTSW	17	57447954	missense	probably damaging	1.00
R4513:Adgre1	UTSW	17	57410947	missense	probably benign	0.34
R4529:Adgre1	UTSW	17	57420519	missense	possibly damaging	0.92
R4543:Adgre1	UTSW	17	57406874	missense	probably benign	0.07
R4610:Adgre1	UTSW	17	57450073	missense	possibly damaging	0.50
R4665:Adgre1	UTSW	17	57480947	missense	probably benign	0.20
R4911:Adgre1	UTSW	17	57447832	missense	possibly damaging	0.57
R4928:Adgre1	UTSW	17	57444064	nonsense	probably null
R4942:Adgre1	UTSW	17	57406903	missense	probably damaging	1.00
R4946:Adgre1	UTSW	17	57443918	missense	probably benign	0.33
R4953:Adgre1	UTSW	17	57441321	missense	probably damaging	0.99
R5107:Adgre1	UTSW	17	57401977	missense	possibly damaging	0.90
R5366:Adgre1	UTSW	17	57402817	missense	probably benign	0.39
R5590:Adgre1	UTSW	17	57445034	missense	probably damaging	1.00
R5619:Adgre1	UTSW	17	57420437	missense	probably benign	0.15
R5699:Adgre1	UTSW	17	57481007	missense	probably benign	0.43
R5734:Adgre1	UTSW	17	57443990	missense	probably benign	0.00
R5860:Adgre1	UTSW	17	57445034	missense	probably damaging	1.00
R6039:Adgre1	UTSW	17	57406859	missense	probably benign	0.28
R6039:Adgre1	UTSW	17	57406859	missense	probably benign	0.28
R6149:Adgre1	UTSW	17	57445018	missense	probably benign	0.08
R6478:Adgre1	UTSW	17	57401955	missense	possibly damaging	0.81
R6709:Adgre1	UTSW	17	57406917	missense	probably benign	0.10
R6864:Adgre1	UTSW	17	57478879	missense	probably damaging	1.00
R6945:Adgre1	UTSW	17	57420399	missense	probably benign	0.39
R6988:Adgre1	UTSW	17	57408445	missense	probably benign	0.00
R7019:Adgre1	UTSW	17	57410945	missense	probably damaging	0.98
R7154:Adgre1	UTSW	17	57444087	splice site	probably null
R7347:Adgre1	UTSW	17	57420441	missense	probably damaging	1.00
R7459:Adgre1	UTSW	17	57449933	missense	probably damaging	1.00
R7709:Adgre1	UTSW	17	57402519	missense	unknown
R7939:Adgre1	UTSW	17	57449938	missense	probably damaging	0.98
R7977:Adgre1	UTSW	17	57447987	missense	possibly damaging	0.54
R7987:Adgre1	UTSW	17	57447987	missense	possibly damaging	0.54
R8187:Adgre1	UTSW	17	57420349	missense	probably benign	0.00
R8210:Adgre1	UTSW	17	57445061	missense	possibly damaging	0.94
R8223:Adgre1	UTSW	17	57361692	missense	probably damaging	0.99
R8344:Adgre1	UTSW	17	57408459	missense	probably benign	0.12
R8698:Adgre1	UTSW	17	57402003	missense	probably benign	0.05
R9236:Adgre1	UTSW	17	57402782	nonsense	probably null
R9262:Adgre1	UTSW	17	57447941	missense	probably damaging	1.00
R9303:Adgre1	UTSW	17	57441275	missense	probably benign	0.00
R9305:Adgre1	UTSW	17	57441275	missense	probably benign	0.00
R9605:Adgre1	UTSW	17	57411083	missense	probably benign	0.00
R9661:Adgre1	UTSW	17	57441368	missense	possibly damaging	0.70
R9678:Adgre1	UTSW	17	57443997	missense	probably damaging	0.96
R9751:Adgre1	UTSW	17	57450101	missense	probably null	0.06
R9785:Adgre1	UTSW	17	57478930	missense	probably damaging	1.00
Z1176:Adgre1	UTSW	17	57361729	missense	possibly damaging	0.76
Z1177:Adgre1	UTSW	17	57419374	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TAACAACAGAAGTGAAACTAGGAATC -3'
(R):5'- AGCCTGGTACATTGGTGCA -3'

Sequencing Primer
(F):5'- GTGAAACTAGGAATCTGGCTTCCC -3'
(R):5'- CATTGGTGCAGACAGAATTCAGTCC -3'

Posted On

2018-11-28