Mutagenetix > Incidental Mutations

Incidental Mutation 'R6945:Celf4'

540867

Institutional Source

Beutler Lab

Gene Symbol

Celf4

Ensembl Gene

ENSMUSG00000024268

Gene Name

CUGBP, Elav-like family member 4

Synonyms

Brunol4, Brul4, BRUNOL-4, A230070D14Rik, C130060B05Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6945 (G1)

Quality Score

222.009

Status

Validated

Chromosome

Chromosomal Location

25477632-25754157 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25496236 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 411 (Q411L)

Ref Sequence

ENSEMBL: ENSMUSP00000153326 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025117] [ENSMUST00000115816] [ENSMUST00000223704] [ENSMUST00000224553] [ENSMUST00000225477]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025117
AA Change: Q401L

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000025117
Gene: ENSMUSG00000024268
AA Change: Q401L

Domain	Start	End	E-Value	Type
RRM	55	131	2.94e-21	SMART
RRM	152	227	3.56e-20	SMART
low complexity region	237	249	N/A	INTRINSIC
low complexity region	258	276	N/A	INTRINSIC
low complexity region	287	309	N/A	INTRINSIC
low complexity region	312	322	N/A	INTRINSIC
low complexity region	376	396	N/A	INTRINSIC
low complexity region	399	412	N/A	INTRINSIC
RRM	420	473	5.29e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115816
AA Change: Q410L

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000111483
Gene: ENSMUSG00000024268
AA Change: Q410L

Domain	Start	End	E-Value	Type
RRM	55	131	2.94e-21	SMART
RRM	152	227	3.56e-20	SMART
low complexity region	237	249	N/A	INTRINSIC
low complexity region	258	276	N/A	INTRINSIC
low complexity region	287	309	N/A	INTRINSIC
low complexity region	312	322	N/A	INTRINSIC
low complexity region	376	396	N/A	INTRINSIC
low complexity region	399	412	N/A	INTRINSIC
RRM	420	493	5.88e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000223704
AA Change: Q411L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224553
AA Change: Q410L

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225477
AA Change: Q410L

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

96% (51/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, shortened life span dependent on genetic background, and seizures. Mice heterozygous for a null allele exhibit complex seizures and abnormal body weights depending on age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	A	C	5: 109,676,845	N246K	probably benign	Het
AA792892	C	T	5: 94,383,631	H125Y	possibly damaging	Het
Abcc5	T	A	16: 20,400,009	T208S	probably benign	Het
Acaa2	A	G	18: 74,793,309	E112G	probably benign	Het
Adgrb1	A	G	15: 74,550,024	N881S	probably damaging	Het
Adgre1	A	G	17: 57,410,844	E314G	probably benign	Het
Adgre1	A	G	17: 57,420,399	E443G	probably benign	Het
Akp3	A	G	1: 87,125,631	Y102C	probably damaging	Het
Birc6	A	G	17: 74,579,531	N618S	probably benign	Het
Bpifc	A	G	10: 85,979,214	V296A	probably benign	Het
Cacna2d3	G	A	14: 28,969,318		probably benign	Het
Cacnb4	T	C	2: 52,474,954	N99S	probably damaging	Het
Cd38	A	G	5: 43,908,006	Y283C	probably damaging	Het
Cemip	A	T	7: 83,998,547	H108Q	probably damaging	Het
Col23a1	A	G	11: 51,561,893	E225G	unknown	Het
Dnah11	T	C	12: 118,060,310	E1902G	probably damaging	Het
Dst	A	G	1: 34,190,490	D2063G	probably damaging	Het
Fsip2	A	T	2: 82,992,840	I6306L	probably benign	Het
Furin	A	G	7: 80,391,090	S667P	possibly damaging	Het
Glmp	T	A	3: 88,325,832	S92R	probably benign	Het
Gm11563	C	G	11: 99,658,472	C152S	unknown	Het
Gm3486	A	G	14: 41,484,561	V185A	probably benign	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Hyal1	C	A	9: 107,579,170	A102E	probably damaging	Het
Invs	T	C	4: 48,421,785	C806R	probably benign	Het
L1td1	T	C	4: 98,733,696	V165A	probably benign	Het
Lama1	A	G	17: 67,813,866	T2666A		Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Lrrc8a	A	G	2: 30,256,227	Y351C	probably damaging	Het
Myh7b	T	C	2: 155,622,232	F551S	possibly damaging	Het
Myo19	A	G	11: 84,897,560	T333A	probably benign	Het
Nrp2	A	T	1: 62,760,788	N387I	probably damaging	Het
Oas2	T	C	5: 120,736,139	D543G	probably benign	Het
Olfr1040	A	G	2: 86,146,084	S217P	probably damaging	Het
Olfr117	A	G	17: 37,659,514	I273T	possibly damaging	Het
Pak7	A	G	2: 136,100,939	V427A	probably benign	Het
Pfas	G	A	11: 69,000,530	A247V	probably benign	Het
Psat1	T	A	19: 15,917,181	T115S	probably benign	Het
Psme4	T	A	11: 30,837,437	D1077E	probably benign	Het
Rabgap1l	A	G	1: 160,682,182	S442P	probably benign	Het
Ralgapa1	A	G	12: 55,776,191	M280T	possibly damaging	Het
Rb1cc1	A	T	1: 6,261,032	E394D	probably damaging	Het
Seh1l	T	C	18: 67,789,390	V271A	probably benign	Het
Sf3b1	A	T	1: 54,997,156	N919K	probably benign	Het
Sftpd	A	G	14: 41,174,492	S245P	possibly damaging	Het
Slc22a15	T	C	3: 101,924,114	E2G	probably damaging	Het
Spta1	A	G	1: 174,209,325	D1134G	possibly damaging	Het
Syna	A	G	5: 134,558,961	V378A	probably damaging	Het
Tchp	A	G	5: 114,709,350	K77E	possibly damaging	Het
Tescl	T	C	7: 24,333,531	N123S	probably benign	Het
Trio	C	T	15: 27,824,090	R1443Q	probably damaging	Het
Trrap	A	T	5: 144,790,855	Y462F	possibly damaging	Het
Vmn1r78	A	G	7: 12,152,905	T148A	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het

Other mutations in Celf4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Celf4	APN	18	25486950	missense	probably damaging	1.00
IGL01608:Celf4	APN	18	25497503	missense	probably damaging	1.00
IGL02353:Celf4	APN	18	25486898	missense	probably damaging	1.00
IGL02360:Celf4	APN	18	25486898	missense	probably damaging	1.00
IGL02614:Celf4	APN	18	25504150	missense	probably damaging	1.00
IGL03183:Celf4	APN	18	25537739	missense	probably benign	0.05
IGL03183:Celf4	APN	18	25537740	missense	probably benign	0.22
R1141:Celf4	UTSW	18	25504904	missense	probably damaging	0.99
R1448:Celf4	UTSW	18	25503083	splice site	probably null
R2442:Celf4	UTSW	18	25753459	missense	probably damaging	1.00
R3958:Celf4	UTSW	18	25537754	missense	probably benign	0.08
R3959:Celf4	UTSW	18	25537754	missense	probably benign	0.08
R3960:Celf4	UTSW	18	25537754	missense	probably benign	0.08
R4256:Celf4	UTSW	18	25491201	missense	probably damaging	0.97
R4650:Celf4	UTSW	18	25496245	missense	possibly damaging	0.79
R6521:Celf4	UTSW	18	25479474	splice site	probably null
R7724:Celf4	UTSW	18	25486793	critical splice donor site	probably null
R7834:Celf4	UTSW	18	25753485	missense	probably benign	0.04
R8000:Celf4	UTSW	18	25504517	missense	probably benign	0.00
R8403:Celf4	UTSW	18	25504270	missense	possibly damaging	0.90
RF048:Celf4	UTSW	18	25501321	missense	probably benign	0.02
Z1088:Celf4	UTSW	18	25496249	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TCCCACAGGATGCACATCTC -3'
(R):5'- TCACCAGGTATCATCTGAGAAGTG -3'

Sequencing Primer
(F):5'- GCACATCTCCTTGTATAAATAGGC -3'
(R):5'- GTGGCCCTTACCAACACTG -3'

Posted On

2018-11-28