Incidental Mutation 'R6945:Acaa2'
ID540869
Institutional Source Beutler Lab
Gene Symbol Acaa2
Ensembl Gene ENSMUSG00000036880
Gene Nameacetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase)
Synonyms0610011L04Rik, D18Ertd240e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R6945 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location74779197-74806207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74793309 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 112 (E112G)
Ref Sequence ENSEMBL: ENSMUSP00000037348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041053]
Predicted Effect probably benign
Transcript: ENSMUST00000041053
AA Change: E112G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000037348
Gene: ENSMUSG00000036880
AA Change: E112G

DomainStartEndE-ValueType
Pfam:Thiolase_N 7 266 1.4e-95 PFAM
Pfam:Thiolase_C 273 395 9e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein catalyzes the last step of the mitochondrial fatty acid beta-oxidation spiral. Unlike most mitochondrial matrix proteins, it contains a non-cleavable amino-terminal targeting signal. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,676,845 N246K probably benign Het
AA792892 C T 5: 94,383,631 H125Y possibly damaging Het
Abcc5 T A 16: 20,400,009 T208S probably benign Het
Adgrb1 A G 15: 74,550,024 N881S probably damaging Het
Adgre1 A G 17: 57,410,844 E314G probably benign Het
Adgre1 A G 17: 57,420,399 E443G probably benign Het
Akp3 A G 1: 87,125,631 Y102C probably damaging Het
Birc6 A G 17: 74,579,531 N618S probably benign Het
Bpifc A G 10: 85,979,214 V296A probably benign Het
Cacna2d3 G A 14: 28,969,318 probably benign Het
Cacnb4 T C 2: 52,474,954 N99S probably damaging Het
Cd38 A G 5: 43,908,006 Y283C probably damaging Het
Celf4 T A 18: 25,496,236 Q411L probably damaging Het
Cemip A T 7: 83,998,547 H108Q probably damaging Het
Col23a1 A G 11: 51,561,893 E225G unknown Het
Dnah11 T C 12: 118,060,310 E1902G probably damaging Het
Dst A G 1: 34,190,490 D2063G probably damaging Het
Fsip2 A T 2: 82,992,840 I6306L probably benign Het
Furin A G 7: 80,391,090 S667P possibly damaging Het
Glmp T A 3: 88,325,832 S92R probably benign Het
Gm11563 C G 11: 99,658,472 C152S unknown Het
Gm3486 A G 14: 41,484,561 V185A probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Hyal1 C A 9: 107,579,170 A102E probably damaging Het
Invs T C 4: 48,421,785 C806R probably benign Het
L1td1 T C 4: 98,733,696 V165A probably benign Het
Lama1 A G 17: 67,813,866 T2666A Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc8a A G 2: 30,256,227 Y351C probably damaging Het
Myh7b T C 2: 155,622,232 F551S possibly damaging Het
Myo19 A G 11: 84,897,560 T333A probably benign Het
Nrp2 A T 1: 62,760,788 N387I probably damaging Het
Oas2 T C 5: 120,736,139 D543G probably benign Het
Olfr1040 A G 2: 86,146,084 S217P probably damaging Het
Olfr117 A G 17: 37,659,514 I273T possibly damaging Het
Pak7 A G 2: 136,100,939 V427A probably benign Het
Pfas G A 11: 69,000,530 A247V probably benign Het
Psat1 T A 19: 15,917,181 T115S probably benign Het
Psme4 T A 11: 30,837,437 D1077E probably benign Het
Rabgap1l A G 1: 160,682,182 S442P probably benign Het
Ralgapa1 A G 12: 55,776,191 M280T possibly damaging Het
Rb1cc1 A T 1: 6,261,032 E394D probably damaging Het
Seh1l T C 18: 67,789,390 V271A probably benign Het
Sf3b1 A T 1: 54,997,156 N919K probably benign Het
Sftpd A G 14: 41,174,492 S245P possibly damaging Het
Slc22a15 T C 3: 101,924,114 E2G probably damaging Het
Spta1 A G 1: 174,209,325 D1134G possibly damaging Het
Syna A G 5: 134,558,961 V378A probably damaging Het
Tchp A G 5: 114,709,350 K77E possibly damaging Het
Tescl T C 7: 24,333,531 N123S probably benign Het
Trio C T 15: 27,824,090 R1443Q probably damaging Het
Trrap A T 5: 144,790,855 Y462F possibly damaging Het
Vmn1r78 A G 7: 12,152,905 T148A probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Acaa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Acaa2 APN 18 74793378 missense probably damaging 1.00
IGL01413:Acaa2 APN 18 74805944 utr 3 prime probably benign
R0129:Acaa2 UTSW 18 74787194 missense probably damaging 0.98
R0615:Acaa2 UTSW 18 74798446 missense probably benign 0.40
R0941:Acaa2 UTSW 18 74798343 missense probably benign 0.00
R1432:Acaa2 UTSW 18 74787127 missense probably damaging 0.99
R1911:Acaa2 UTSW 18 74792412 missense probably benign 0.19
R2156:Acaa2 UTSW 18 74793405 critical splice donor site probably null
R5620:Acaa2 UTSW 18 74805874 missense possibly damaging 0.91
R5880:Acaa2 UTSW 18 74804001 missense probably damaging 1.00
R5943:Acaa2 UTSW 18 74792382 missense probably damaging 1.00
R5966:Acaa2 UTSW 18 74804152 missense probably damaging 1.00
R7378:Acaa2 UTSW 18 74805872 missense probably benign 0.12
R7557:Acaa2 UTSW 18 74795159 missense possibly damaging 0.82
R7625:Acaa2 UTSW 18 74804142 missense possibly damaging 0.90
R7786:Acaa2 UTSW 18 74792447 missense probably damaging 1.00
X0018:Acaa2 UTSW 18 74792409 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCACTGGTGTCTTTAAGTAGATTC -3'
(R):5'- TCCATGAACAAAGCTGGGTTC -3'

Sequencing Primer
(F):5'- TCTTTAACATCAGCATTTCAACAAC -3'
(R):5'- CAAAGCTGGGTTCAAAGTTACTC -3'
Posted On2018-11-28