Incidental Mutation 'R6946:Vipr2'
ID540899
Institutional Source Beutler Lab
Gene Symbol Vipr2
Ensembl Gene ENSMUSG00000011171
Gene Namevasoactive intestinal peptide receptor 2
SynonymsVPAC2R, VPAC2, VIP receptor subtype 2, Vip2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6946 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location116077726-116146261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116139199 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 310 (T310S)
Ref Sequence ENSEMBL: ENSMUSP00000011315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011315]
Predicted Effect possibly damaging
Transcript: ENSMUST00000011315
AA Change: T310S

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000011315
Gene: ENSMUSG00000011171
AA Change: T310S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HormR 47 117 8.35e-25 SMART
Pfam:7tm_2 122 370 1.5e-81 PFAM
Predicted Effect
Meta Mutation Damage Score 0.0799 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for vasoactive intestinal peptide, a small neuropeptide. Vasoactive intestinal peptide is involved in smooth muscle relaxation, exocrine and endocrine secretion, and water and ion flux in lung and intestinal epithelia. Its actions are effected through integral membrane receptors associated with a guanine nucleotide binding protein which activates adenylate cyclase. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit enhanced delayed-type hypersensitivity (type IV) and reduced immediate-type hypersensitivity (type I). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,679,227 S481C probably damaging Het
Atp8a1 T C 5: 67,622,625 T1142A possibly damaging Het
Atxn1l G T 8: 109,732,016 P538H probably damaging Het
Carmil1 T C 13: 24,115,545 N332S possibly damaging Het
Clec4b2 C T 6: 123,201,028 Q101* probably null Het
Clstn2 A T 9: 97,469,822 F517I probably damaging Het
Dap3 T A 3: 88,938,216 probably benign Het
Dgki C A 6: 37,299,636 G105* probably null Het
Dnm3 T C 1: 162,313,655 E345G possibly damaging Het
Fam120a A T 13: 48,881,020 S1039T possibly damaging Het
Gpr132 T A 12: 112,852,210 Y332F probably benign Het
Ifi44 A T 3: 151,745,899 I190N possibly damaging Het
Ighv1-42 T A 12: 114,937,535 N4Y possibly damaging Het
Igll1 A G 16: 16,861,056 V130A probably damaging Het
Ikzf2 T A 1: 69,577,796 K137* probably null Het
Klra9 T A 6: 130,179,040 I251F probably benign Het
Lrp1b T C 2: 40,697,439 I166V probably benign Het
Map3k1 C T 13: 111,768,501 W213* probably null Het
Map3k12 A G 15: 102,505,134 M134T possibly damaging Het
Mfsd3 T A 15: 76,703,149 M344K probably damaging Het
Mier2 C A 10: 79,540,839 probably benign Het
Nop53 C T 7: 15,938,358 R462Q probably damaging Het
Olfr1085 T A 2: 86,657,588 Y290F probably damaging Het
Olfr502 T A 7: 108,523,321 I210F probably benign Het
Olfr867 A T 9: 20,055,374 L30M possibly damaging Het
Olfr948 C A 9: 39,319,019 L198F probably damaging Het
Oog2 A T 4: 144,196,464 D433V possibly damaging Het
Pan2 A G 10: 128,315,637 T867A probably benign Het
Pcdhb3 T A 18: 37,302,619 L546Q probably damaging Het
Plcg2 A T 8: 117,504,190 M4L probably benign Het
Prss21 T C 17: 23,868,164 S24P possibly damaging Het
Ryr3 T C 2: 112,831,200 D1815G probably damaging Het
Scd4 A G 19: 44,333,514 E8G probably null Het
Sec31b T C 19: 44,534,316 D79G probably damaging Het
Siah1a G T 8: 86,725,142 A238E probably damaging Het
Spag17 G A 3: 100,004,683 E290K possibly damaging Het
Srl T C 16: 4,482,559 I883V probably benign Het
Tas2r117 T C 6: 132,803,325 L142S probably damaging Het
Tcrg-V1 T C 13: 19,340,020 L2P probably benign Het
Ttn A T 2: 76,749,855 W23565R probably damaging Het
Zfp112 A T 7: 24,125,341 N245Y probably damaging Het
Other mutations in Vipr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Vipr2 APN 12 116138748 splice site probably null
IGL02233:Vipr2 APN 12 116094736 missense probably damaging 0.99
IGL02691:Vipr2 APN 12 116136229 missense probably benign 0.11
PIT4377001:Vipr2 UTSW 12 116094798 missense probably benign 0.01
R0135:Vipr2 UTSW 12 116142827 missense probably benign 0.00
R0207:Vipr2 UTSW 12 116142882 missense probably damaging 1.00
R1389:Vipr2 UTSW 12 116137330 missense probably benign 0.01
R1560:Vipr2 UTSW 12 116094781 missense probably benign 0.18
R1575:Vipr2 UTSW 12 116144272 missense probably benign
R1696:Vipr2 UTSW 12 116139157 missense probably benign 0.13
R1970:Vipr2 UTSW 12 116136206 missense probably benign 0.01
R2010:Vipr2 UTSW 12 116122810 critical splice donor site probably null
R3873:Vipr2 UTSW 12 116136104 unclassified probably benign
R4713:Vipr2 UTSW 12 116080131 missense probably benign 0.00
R4953:Vipr2 UTSW 12 116144256 missense probably benign 0.07
R6041:Vipr2 UTSW 12 116142984 missense probably damaging 1.00
R6337:Vipr2 UTSW 12 116122743 nonsense probably null
R6902:Vipr2 UTSW 12 116139199 missense possibly damaging 0.46
R7763:Vipr2 UTSW 12 116122718 missense probably damaging 1.00
X0066:Vipr2 UTSW 12 116142945 splice site probably null
X0067:Vipr2 UTSW 12 116139172 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAACTTTATGCAGTAGTACC -3'
(R):5'- AGACTCCAGTGTCAGTGCAC -3'

Sequencing Primer
(F):5'- TATGCAGTAGTACCCTCAATGC -3'
(R):5'- CAGTGCACGTTGAGCCTTAGAG -3'
Posted On2018-11-28