Incidental Mutation 'R6946:Scd4'
ID 540910
Institutional Source Beutler Lab
Gene Symbol Scd4
Ensembl Gene ENSMUSG00000050195
Gene Name stearoyl-coenzyme A desaturase 4
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock # R6946 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 44333092-44346743 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44333514 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 8 (E8G)
Ref Sequence ENSEMBL: ENSMUSP00000059860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058856]
AlphaFold Q6T707
Predicted Effect probably null
Transcript: ENSMUST00000058856
AA Change: E8G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000059860
Gene: ENSMUSG00000050195
AA Change: E8G

DomainStartEndE-ValueType
transmembrane domain 65 87 N/A INTRINSIC
Pfam:FA_desaturase 91 311 7e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,679,227 S481C probably damaging Het
Atp8a1 T C 5: 67,622,625 T1142A possibly damaging Het
Atxn1l G T 8: 109,732,016 P538H probably damaging Het
Carmil1 T C 13: 24,115,545 N332S possibly damaging Het
Clec4b2 C T 6: 123,201,028 Q101* probably null Het
Clstn2 A T 9: 97,469,822 F517I probably damaging Het
Dap3 T A 3: 88,938,216 probably benign Het
Dgki C A 6: 37,299,636 G105* probably null Het
Dnm3 T C 1: 162,313,655 E345G possibly damaging Het
Fam120a A T 13: 48,881,020 S1039T possibly damaging Het
Gpr132 T A 12: 112,852,210 Y332F probably benign Het
Ifi44 A T 3: 151,745,899 I190N possibly damaging Het
Ighv1-42 T A 12: 114,937,535 N4Y possibly damaging Het
Igll1 A G 16: 16,861,056 V130A probably damaging Het
Ikzf2 T A 1: 69,577,796 K137* probably null Het
Klra9 T A 6: 130,179,040 I251F probably benign Het
Lrp1b T C 2: 40,697,439 I166V probably benign Het
Map3k1 C T 13: 111,768,501 W213* probably null Het
Map3k12 A G 15: 102,505,134 M134T possibly damaging Het
Mfsd3 T A 15: 76,703,149 M344K probably damaging Het
Mier2 C A 10: 79,540,839 probably benign Het
Nop53 C T 7: 15,938,358 R462Q probably damaging Het
Olfr1085 T A 2: 86,657,588 Y290F probably damaging Het
Olfr502 T A 7: 108,523,321 I210F probably benign Het
Olfr867 A T 9: 20,055,374 L30M possibly damaging Het
Olfr948 C A 9: 39,319,019 L198F probably damaging Het
Oog2 A T 4: 144,196,464 D433V possibly damaging Het
Pan2 A G 10: 128,315,637 T867A probably benign Het
Pcdhb3 T A 18: 37,302,619 L546Q probably damaging Het
Plcg2 A T 8: 117,504,190 M4L probably benign Het
Prss21 T C 17: 23,868,164 S24P possibly damaging Het
Ryr3 T C 2: 112,831,200 D1815G probably damaging Het
Sec31b T C 19: 44,534,316 D79G probably damaging Het
Siah1a G T 8: 86,725,142 A238E probably damaging Het
Spag17 G A 3: 100,004,683 E290K possibly damaging Het
Srl T C 16: 4,482,559 I883V probably benign Het
Tas2r117 T C 6: 132,803,325 L142S probably damaging Het
Tcrg-V1 T C 13: 19,340,020 L2P probably benign Het
Ttn A T 2: 76,749,855 W23565R probably damaging Het
Vipr2 A T 12: 116,139,199 T310S possibly damaging Het
Zfp112 A T 7: 24,125,341 N245Y probably damaging Het
Other mutations in Scd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Scd4 APN 19 44344747 missense possibly damaging 0.54
IGL02824:Scd4 APN 19 44341259 missense probably damaging 1.00
crisco UTSW 19 44339071 missense probably benign 0.24
IGL03098:Scd4 UTSW 19 44333492 start codon destroyed possibly damaging 0.92
R0576:Scd4 UTSW 19 44341246 missense probably benign 0.00
R0655:Scd4 UTSW 19 44338968 missense possibly damaging 0.52
R1792:Scd4 UTSW 19 44337574 nonsense probably null
R1925:Scd4 UTSW 19 44341384 missense probably damaging 0.99
R1995:Scd4 UTSW 19 44334178 missense possibly damaging 0.93
R5018:Scd4 UTSW 19 44337609 missense probably benign 0.09
R5815:Scd4 UTSW 19 44337564 missense probably damaging 1.00
R6036:Scd4 UTSW 19 44344792 missense probably damaging 0.98
R6036:Scd4 UTSW 19 44344792 missense probably damaging 0.98
R6264:Scd4 UTSW 19 44338959 nonsense probably null
R7661:Scd4 UTSW 19 44339071 missense probably benign 0.24
R7957:Scd4 UTSW 19 44341248 missense probably benign 0.00
R8112:Scd4 UTSW 19 44337506 missense probably benign 0.00
R8226:Scd4 UTSW 19 44334133 missense probably benign 0.00
R9752:Scd4 UTSW 19 44334036 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAACTGACTGGTGACACCTG -3'
(R):5'- CATGCAGAAAGGTATTGGCTGG -3'

Sequencing Primer
(F):5'- ACTGGTGACACCTGCACAGTTAG -3'
(R):5'- ACGGGAGCTTTCTTTCCTTTAAAG -3'
Posted On 2018-11-28