Incidental Mutation 'R6947:Cxxc4'
ID540917
Institutional Source Beutler Lab
Gene Symbol Cxxc4
Ensembl Gene ENSMUSG00000044365
Gene NameCXXC finger 4
Synonyms9330210J02Rik, C030003J12Rik, Idax
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6947 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location134236484-134262161 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 134240516 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 286 (S286F)
Ref Sequence ENSEMBL: ENSMUSP00000138000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166288] [ENSMUST00000181904]
Predicted Effect probably benign
Transcript: ENSMUST00000166288
AA Change: S118F

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000128574
Gene: ENSMUSG00000044365
AA Change: S118F

DomainStartEndE-ValueType
low complexity region 87 102 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
Pfam:zf-CXXC 131 172 5.1e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000181904
AA Change: S286F

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138000
Gene: ENSMUSG00000044365
AA Change: S286F

DomainStartEndE-ValueType
low complexity region 94 101 N/A INTRINSIC
low complexity region 105 165 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Pfam:zf-CXXC 299 340 5.8e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CXXC-type zinc finger domain-containing protein that functions as an antagonist of the canonical wingless/integrated signaling pathway. The encoded protein negatively regulates wingless/integrated signaling through interaction with the post synaptic density protein/ Drosophila disc large tumor suppressor/ zonula occludens-1 protein domain of Dishevelled, a scaffolding protein required for the stabilization of the transcriptional co-activator beta-catenin. In addition, the CXXC domain of this protein has been shown to bind unmethylated CpG dinucleotides, localize to promoters and CpG islands, and interact with the catalytic domain of methylcytosine dioxygenase ten-eleven-translocation 2, an iron and alpha-ketoglutarate-dependent dioxygenase that modifies the methylation status of DNA. In humans, a mutation in this gene has been associated with development of malignant renal cell carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 C A 9: 90,191,804 probably null Het
Adcy4 T C 14: 55,778,391 T414A possibly damaging Het
Bop1 A G 15: 76,453,988 F561L probably damaging Het
Ccdc18 T C 5: 108,161,535 V332A probably benign Het
Cep290 A G 10: 100,530,056 T1042A probably damaging Het
Cnot8 G T 11: 58,117,505 V266L probably benign Het
Cyp2d12 A T 15: 82,559,047 I386L probably benign Het
Dgka A T 10: 128,733,015 I227N probably damaging Het
Eif2d T C 1: 131,164,667 V354A probably benign Het
Fgr T A 4: 132,995,069 probably null Het
Idnk A G 13: 58,160,241 probably null Het
Kmt2e T C 5: 23,497,545 S952P probably damaging Het
Kng1 A G 16: 23,077,374 H343R probably benign Het
Lgals8 G A 13: 12,454,801 probably benign Het
Lrit3 T A 3: 129,789,234 Q368L probably benign Het
Lypd8 A T 11: 58,382,766 T24S probably benign Het
Map3k4 G A 17: 12,260,569 Q704* probably null Het
Mcm3ap A G 10: 76,515,666 I1948V probably benign Het
Mettl25 A G 10: 105,826,192 F306L probably benign Het
Mos A C 4: 3,871,585 V77G probably damaging Het
Muc4 C T 16: 32,775,803 R3130C possibly damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nup107 A G 10: 117,757,274 V833A probably benign Het
Olfr1022 T C 2: 85,868,927 F112L probably benign Het
Olfr409-ps1 C T 11: 74,317,544 S173L unknown Het
Pcnx2 C T 8: 125,850,282 probably null Het
Pde10a T A 17: 8,969,592 I908N probably damaging Het
Plcb1 A G 2: 135,386,155 K1058R probably benign Het
Rad17 A T 13: 100,622,875 F548Y probably damaging Het
Rad54b T G 4: 11,569,859 S58R possibly damaging Het
Rbm20 G A 19: 53,851,265 G895D probably damaging Het
Rgs22 T C 15: 36,103,890 probably null Het
Rhobtb3 A G 13: 75,910,666 S338P probably benign Het
Ruvbl2 A G 7: 45,424,949 probably null Het
Slc16a12 A G 19: 34,672,607 F343L probably benign Het
Slc22a28 A G 19: 8,064,510 L444P possibly damaging Het
Slc44a4 A T 17: 34,928,068 Q358L probably null Het
Sowaha A G 11: 53,478,398 F504L probably benign Het
Syne1 A G 10: 5,175,789 L6035P probably damaging Het
Thbs2 A T 17: 14,689,767 M190K possibly damaging Het
Tmem171 A G 13: 98,688,442 F227L possibly damaging Het
Trp53 A G 11: 69,588,481 K162E possibly damaging Het
Ttn T A 2: 76,894,388 K2098* probably null Het
Usp30 T C 5: 114,103,760 S88P probably benign Het
Zfp276 C A 8: 123,254,904 D63E probably benign Het
Other mutations in Cxxc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Cxxc4 APN 3 134240659 missense probably null 0.99
R1839:Cxxc4 UTSW 3 134240653 missense probably damaging 1.00
R6265:Cxxc4 UTSW 3 134258063 missense probably benign 0.02
R6744:Cxxc4 UTSW 3 134240130 small insertion probably benign
R7764:Cxxc4 UTSW 3 134240095 missense unknown
R7842:Cxxc4 UTSW 3 134240332 missense possibly damaging 0.93
R7860:Cxxc4 UTSW 3 134258053 missense probably benign 0.21
Z1177:Cxxc4 UTSW 3 134240050 missense unknown
Predicted Primers PCR Primer
(F):5'- TAATGAATCTCCCCGAGCGG -3'
(R):5'- AAATCATCTCCTCTGACCTCTAGCG -3'

Sequencing Primer
(F):5'- AGCGGGTGGGGACTTTTTCC -3'
(R):5'- TCTGACCTCTAGCGAAGTGC -3'
Posted On2018-11-28