Incidental Mutation 'R6947:Mos'
ID540918
Institutional Source Beutler Lab
Gene Symbol Mos
Ensembl Gene ENSMUSG00000078365
Gene NameMoloney sarcoma oncogene
Synonymsc-mos
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6947 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location3870657-3872105 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 3871585 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 77 (V77G)
Ref Sequence ENSEMBL: ENSMUSP00000100789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105158]
Predicted Effect probably damaging
Transcript: ENSMUST00000105158
AA Change: V77G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100789
Gene: ENSMUSG00000078365
AA Change: V77G

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
Pfam:Pkinase_Tyr 63 335 9e-41 PFAM
Pfam:Pkinase 64 334 6.3e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MOS is a serine/threonine kinase that activates the MAP kinase cascade through direct phosphorylation of the MAP kinase activator MEK (MAP2K1; MIM 176872) (Prasad et al., 2008 [PubMed 18246541]).[supplied by OMIM, Jul 2009]
PHENOTYPE: Mutations that inactivate the gene result in female infertility and an increased susceptibility to tumors. Oocytes progress through meiosis II without arrest and undergo spontaneous parthenogenetic activation. Male mice are fertile and show no spermatogenic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 C A 9: 90,191,804 probably null Het
Adcy4 T C 14: 55,778,391 T414A possibly damaging Het
Bop1 A G 15: 76,453,988 F561L probably damaging Het
Ccdc18 T C 5: 108,161,535 V332A probably benign Het
Cep290 A G 10: 100,530,056 T1042A probably damaging Het
Cnot8 G T 11: 58,117,505 V266L probably benign Het
Cxxc4 C T 3: 134,240,516 S286F possibly damaging Het
Cyp2d12 A T 15: 82,559,047 I386L probably benign Het
Dgka A T 10: 128,733,015 I227N probably damaging Het
Eif2d T C 1: 131,164,667 V354A probably benign Het
Fgr T A 4: 132,995,069 probably null Het
Idnk A G 13: 58,160,241 probably null Het
Kmt2e T C 5: 23,497,545 S952P probably damaging Het
Kng1 A G 16: 23,077,374 H343R probably benign Het
Lgals8 G A 13: 12,454,801 probably benign Het
Lrit3 T A 3: 129,789,234 Q368L probably benign Het
Lypd8 A T 11: 58,382,766 T24S probably benign Het
Map3k4 G A 17: 12,260,569 Q704* probably null Het
Mcm3ap A G 10: 76,515,666 I1948V probably benign Het
Mettl25 A G 10: 105,826,192 F306L probably benign Het
Muc4 C T 16: 32,775,803 R3130C possibly damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nup107 A G 10: 117,757,274 V833A probably benign Het
Olfr1022 T C 2: 85,868,927 F112L probably benign Het
Olfr409-ps1 C T 11: 74,317,544 S173L unknown Het
Pcnx2 C T 8: 125,850,282 probably null Het
Pde10a T A 17: 8,969,592 I908N probably damaging Het
Plcb1 A G 2: 135,386,155 K1058R probably benign Het
Rad17 A T 13: 100,622,875 F548Y probably damaging Het
Rad54b T G 4: 11,569,859 S58R possibly damaging Het
Rbm20 G A 19: 53,851,265 G895D probably damaging Het
Rgs22 T C 15: 36,103,890 probably null Het
Rhobtb3 A G 13: 75,910,666 S338P probably benign Het
Ruvbl2 A G 7: 45,424,949 probably null Het
Slc16a12 A G 19: 34,672,607 F343L probably benign Het
Slc22a28 A G 19: 8,064,510 L444P possibly damaging Het
Slc44a4 A T 17: 34,928,068 Q358L probably null Het
Sowaha A G 11: 53,478,398 F504L probably benign Het
Syne1 A G 10: 5,175,789 L6035P probably damaging Het
Thbs2 A T 17: 14,689,767 M190K possibly damaging Het
Tmem171 A G 13: 98,688,442 F227L possibly damaging Het
Trp53 A G 11: 69,588,481 K162E possibly damaging Het
Ttn T A 2: 76,894,388 K2098* probably null Het
Usp30 T C 5: 114,103,760 S88P probably benign Het
Zfp276 C A 8: 123,254,904 D63E probably benign Het
Other mutations in Mos
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Mos APN 4 3871459 missense probably damaging 1.00
IGL01302:Mos APN 4 3871815 utr 5 prime probably benign
IGL01739:Mos APN 4 3871816 utr 5 prime probably benign
IGL01867:Mos APN 4 3870845 missense probably benign 0.33
IGL02647:Mos APN 4 3870961 missense probably damaging 1.00
PIT4418001:Mos UTSW 4 3870814 missense possibly damaging 0.86
R0967:Mos UTSW 4 3870932 missense probably benign
R4927:Mos UTSW 4 3871093 missense probably damaging 1.00
R5729:Mos UTSW 4 3870971 missense probably benign 0.01
R8359:Mos UTSW 4 3871097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTAGGCTGTTGGAGTCTTC -3'
(R):5'- TCTAAGCCTGTGTCGCTACC -3'

Sequencing Primer
(F):5'- GGAGTCTTCGGGCGTGC -3'
(R):5'- TCGTGAGCTGTCGCCATC -3'
Posted On2018-11-28