Incidental Mutation 'R6947:Fgr'
ID540920
Institutional Source Beutler Lab
Gene Symbol Fgr
Ensembl Gene ENSMUSG00000028874
Gene NameFGR proto-oncogene, Src family tyrosine kinase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R6947 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location132974095-133001910 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 132995069 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030693] [ENSMUST00000171223]
Predicted Effect probably null
Transcript: ENSMUST00000030693
SMART Domains Protein: ENSMUSP00000030693
Gene: ENSMUSG00000028874

DomainStartEndE-ValueType
SH3 68 125 5.39e-22 SMART
SH2 130 220 5.25e-36 SMART
TyrKc 251 500 5.5e-126 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171223
SMART Domains Protein: ENSMUSP00000128411
Gene: ENSMUSG00000028874

DomainStartEndE-ValueType
SH3 68 125 5.39e-22 SMART
SH2 130 220 5.25e-36 SMART
TyrKc 251 500 5.5e-126 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to plasma membrane ruffles, and functions as a negative regulator of cell migration and adhesion triggered by the beta-2 integrin signal transduction pathway. Infection with Epstein-Barr virus results in the overexpression of this gene. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial reduction in hemorrhage following induction of a local Shwartzman reaction, and show enhanced NK-cell receptor-induced IFN-gamma production in natural killer (NK) cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 C A 9: 90,191,804 probably null Het
Adcy4 T C 14: 55,778,391 T414A possibly damaging Het
Bop1 A G 15: 76,453,988 F561L probably damaging Het
Ccdc18 T C 5: 108,161,535 V332A probably benign Het
Cep290 A G 10: 100,530,056 T1042A probably damaging Het
Cnot8 G T 11: 58,117,505 V266L probably benign Het
Cxxc4 C T 3: 134,240,516 S286F possibly damaging Het
Cyp2d12 A T 15: 82,559,047 I386L probably benign Het
Dgka A T 10: 128,733,015 I227N probably damaging Het
Eif2d T C 1: 131,164,667 V354A probably benign Het
Idnk A G 13: 58,160,241 probably null Het
Kmt2e T C 5: 23,497,545 S952P probably damaging Het
Kng1 A G 16: 23,077,374 H343R probably benign Het
Lgals8 G A 13: 12,454,801 probably benign Het
Lrit3 T A 3: 129,789,234 Q368L probably benign Het
Lypd8 A T 11: 58,382,766 T24S probably benign Het
Map3k4 G A 17: 12,260,569 Q704* probably null Het
Mcm3ap A G 10: 76,515,666 I1948V probably benign Het
Mettl25 A G 10: 105,826,192 F306L probably benign Het
Mos A C 4: 3,871,585 V77G probably damaging Het
Muc4 C T 16: 32,775,803 R3130C possibly damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nup107 A G 10: 117,757,274 V833A probably benign Het
Olfr1022 T C 2: 85,868,927 F112L probably benign Het
Olfr409-ps1 C T 11: 74,317,544 S173L unknown Het
Pcnx2 C T 8: 125,850,282 probably null Het
Pde10a T A 17: 8,969,592 I908N probably damaging Het
Plcb1 A G 2: 135,386,155 K1058R probably benign Het
Rad17 A T 13: 100,622,875 F548Y probably damaging Het
Rad54b T G 4: 11,569,859 S58R possibly damaging Het
Rbm20 G A 19: 53,851,265 G895D probably damaging Het
Rgs22 T C 15: 36,103,890 probably null Het
Rhobtb3 A G 13: 75,910,666 S338P probably benign Het
Ruvbl2 A G 7: 45,424,949 probably null Het
Slc16a12 A G 19: 34,672,607 F343L probably benign Het
Slc22a28 A G 19: 8,064,510 L444P possibly damaging Het
Slc44a4 A T 17: 34,928,068 Q358L probably null Het
Sowaha A G 11: 53,478,398 F504L probably benign Het
Syne1 A G 10: 5,175,789 L6035P probably damaging Het
Thbs2 A T 17: 14,689,767 M190K possibly damaging Het
Tmem171 A G 13: 98,688,442 F227L possibly damaging Het
Trp53 A G 11: 69,588,481 K162E possibly damaging Het
Ttn T A 2: 76,894,388 K2098* probably null Het
Usp30 T C 5: 114,103,760 S88P probably benign Het
Zfp276 C A 8: 123,254,904 D63E probably benign Het
Other mutations in Fgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02201:Fgr APN 4 132994924 missense probably damaging 0.99
IGL03089:Fgr APN 4 132986266 missense probably damaging 0.96
R1760:Fgr UTSW 4 132998342 missense possibly damaging 0.72
R1957:Fgr UTSW 4 132998362 missense probably benign
R2011:Fgr UTSW 4 132997521 missense probably damaging 1.00
R2109:Fgr UTSW 4 132998475 missense probably benign 0.32
R2351:Fgr UTSW 4 132997237 missense probably damaging 0.99
R2941:Fgr UTSW 4 132998423 missense probably benign
R3034:Fgr UTSW 4 132998496 critical splice donor site probably null
R4590:Fgr UTSW 4 132995053 missense probably damaging 1.00
R4770:Fgr UTSW 4 132987291 missense probably damaging 0.99
R4847:Fgr UTSW 4 132994648 missense probably damaging 1.00
R5294:Fgr UTSW 4 132997500 missense probably benign 0.01
R5384:Fgr UTSW 4 132986353 critical splice donor site probably null
R5388:Fgr UTSW 4 132995031 missense probably damaging 1.00
R5650:Fgr UTSW 4 133000222 missense probably benign 0.13
R7651:Fgr UTSW 4 132995013 missense probably damaging 1.00
R7686:Fgr UTSW 4 132998013 missense probably benign
R8011:Fgr UTSW 4 132998479 missense probably damaging 1.00
Z1176:Fgr UTSW 4 133000170 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AAGCTGGGCTCTGGGAATTC -3'
(R):5'- CTTAGGCCTGGAAGCAAGATTAGG -3'

Sequencing Primer
(F):5'- GAATTCCTTTGGGGGCCTCC -3'
(R):5'- CAAGATTAGGAGGCATTGCTTG -3'
Posted On2018-11-28