Incidental Mutation 'R6947:Nup107'
ID540932
Institutional Source Beutler Lab
Gene Symbol Nup107
Ensembl Gene ENSMUSG00000052798
Gene Namenucleoporin 107
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R6947 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location117750621-117792705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117757274 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 833 (V833A)
Ref Sequence ENSEMBL: ENSMUSP00000063590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064848] [ENSMUST00000167943] [ENSMUST00000218576]
Predicted Effect probably benign
Transcript: ENSMUST00000064848
AA Change: V833A

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000063590
Gene: ENSMUSG00000052798
AA Change: V833A

DomainStartEndE-ValueType
Pfam:Nup84_Nup100 210 909 2.2e-218 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167943
AA Change: V831A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129546
Gene: ENSMUSG00000052798
AA Change: V831A

DomainStartEndE-ValueType
Pfam:Nup84_Nup100 206 909 2.4e-226 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218375
Predicted Effect probably benign
Transcript: ENSMUST00000218576
Meta Mutation Damage Score 0.0864 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleoporin family. The protein is localized to the nuclear rim and is an essential component of the nuclear pore complex (NPC). All molecules entering or leaving the nucleus either diffuse through or are actively transported by the NPC. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a CRISPR-generated allele exhibit reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 C A 9: 90,191,804 probably null Het
Adcy4 T C 14: 55,778,391 T414A possibly damaging Het
Bop1 A G 15: 76,453,988 F561L probably damaging Het
Ccdc18 T C 5: 108,161,535 V332A probably benign Het
Cep290 A G 10: 100,530,056 T1042A probably damaging Het
Cnot8 G T 11: 58,117,505 V266L probably benign Het
Cxxc4 C T 3: 134,240,516 S286F possibly damaging Het
Cyp2d12 A T 15: 82,559,047 I386L probably benign Het
Dgka A T 10: 128,733,015 I227N probably damaging Het
Eif2d T C 1: 131,164,667 V354A probably benign Het
Fgr T A 4: 132,995,069 probably null Het
Idnk A G 13: 58,160,241 probably null Het
Kmt2e T C 5: 23,497,545 S952P probably damaging Het
Kng1 A G 16: 23,077,374 H343R probably benign Het
Lgals8 G A 13: 12,454,801 probably benign Het
Lrit3 T A 3: 129,789,234 Q368L probably benign Het
Lypd8 A T 11: 58,382,766 T24S probably benign Het
Map3k4 G A 17: 12,260,569 Q704* probably null Het
Mcm3ap A G 10: 76,515,666 I1948V probably benign Het
Mettl25 A G 10: 105,826,192 F306L probably benign Het
Mos A C 4: 3,871,585 V77G probably damaging Het
Muc4 C T 16: 32,775,803 R3130C possibly damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Olfr1022 T C 2: 85,868,927 F112L probably benign Het
Olfr409-ps1 C T 11: 74,317,544 S173L unknown Het
Pcnx2 C T 8: 125,850,282 probably null Het
Pde10a T A 17: 8,969,592 I908N probably damaging Het
Plcb1 A G 2: 135,386,155 K1058R probably benign Het
Rad17 A T 13: 100,622,875 F548Y probably damaging Het
Rad54b T G 4: 11,569,859 S58R possibly damaging Het
Rbm20 G A 19: 53,851,265 G895D probably damaging Het
Rgs22 T C 15: 36,103,890 probably null Het
Rhobtb3 A G 13: 75,910,666 S338P probably benign Het
Ruvbl2 A G 7: 45,424,949 probably null Het
Slc16a12 A G 19: 34,672,607 F343L probably benign Het
Slc22a28 A G 19: 8,064,510 L444P possibly damaging Het
Slc44a4 A T 17: 34,928,068 Q358L probably null Het
Sowaha A G 11: 53,478,398 F504L probably benign Het
Syne1 A G 10: 5,175,789 L6035P probably damaging Het
Thbs2 A T 17: 14,689,767 M190K possibly damaging Het
Tmem171 A G 13: 98,688,442 F227L possibly damaging Het
Trp53 A G 11: 69,588,481 K162E possibly damaging Het
Ttn T A 2: 76,894,388 K2098* probably null Het
Usp30 T C 5: 114,103,760 S88P probably benign Het
Zfp276 C A 8: 123,254,904 D63E probably benign Het
Other mutations in Nup107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Nup107 APN 10 117763803 missense probably damaging 1.00
IGL00595:Nup107 APN 10 117773352 nonsense probably null
IGL00595:Nup107 APN 10 117773368 critical splice acceptor site probably null
IGL01120:Nup107 APN 10 117770241 splice site probably benign
IGL01420:Nup107 APN 10 117785021 missense probably damaging 1.00
IGL01646:Nup107 APN 10 117781342 missense probably damaging 1.00
IGL01748:Nup107 APN 10 117757274 missense probably benign 0.06
IGL01755:Nup107 APN 10 117774493 missense probably damaging 1.00
IGL01982:Nup107 APN 10 117759340 splice site probably benign
IGL03394:Nup107 APN 10 117782028 missense probably damaging 0.96
R0371:Nup107 UTSW 10 117763769 missense probably damaging 0.98
R1036:Nup107 UTSW 10 117757294 missense probably damaging 0.98
R1186:Nup107 UTSW 10 117777146 nonsense probably null
R1538:Nup107 UTSW 10 117790494 missense probably damaging 0.96
R1555:Nup107 UTSW 10 117751490 splice site probably benign
R1570:Nup107 UTSW 10 117763844 missense possibly damaging 0.49
R1758:Nup107 UTSW 10 117761343 missense probably damaging 1.00
R1856:Nup107 UTSW 10 117750906 missense probably damaging 1.00
R2105:Nup107 UTSW 10 117773320 missense probably damaging 1.00
R2127:Nup107 UTSW 10 117774475 missense possibly damaging 0.69
R4480:Nup107 UTSW 10 117761332 missense probably benign 0.00
R4540:Nup107 UTSW 10 117762020 splice site probably null
R4584:Nup107 UTSW 10 117766368 missense probably benign 0.05
R4878:Nup107 UTSW 10 117751418 missense probably benign 0.17
R4887:Nup107 UTSW 10 117770478 missense probably damaging 1.00
R4921:Nup107 UTSW 10 117770511 missense possibly damaging 0.95
R5960:Nup107 UTSW 10 117790010 missense probably null
R5986:Nup107 UTSW 10 117759176 missense probably damaging 1.00
R7092:Nup107 UTSW 10 117790494 missense probably damaging 0.96
R7165:Nup107 UTSW 10 117773362 missense probably damaging 0.98
R7190:Nup107 UTSW 10 117762135 missense probably benign
R7331:Nup107 UTSW 10 117770198 missense probably damaging 0.99
R7405:Nup107 UTSW 10 117770415 missense probably benign 0.02
R7596:Nup107 UTSW 10 117777160 missense probably damaging 1.00
R7644:Nup107 UTSW 10 117770470 missense probably damaging 1.00
R7734:Nup107 UTSW 10 117758012 nonsense probably null
R7998:Nup107 UTSW 10 117757994 missense probably damaging 1.00
R8060:Nup107 UTSW 10 117763769 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACACTTGTGTTGGTACCCATC -3'
(R):5'- TGAGTCAGCTCATAAGAATGATGG -3'

Sequencing Primer
(F):5'- CCATCTGTGGGTCTGCTG -3'
(R):5'- CAGCTCATAAGAATGATGGTTTGTC -3'
Posted On2018-11-28