Incidental Mutation 'R6947:Cnot8'
ID540935
Institutional Source Beutler Lab
Gene Symbol Cnot8
Ensembl Gene ENSMUSG00000020515
Gene NameCCR4-NOT transcription complex, subunit 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R6947 (G1)
Quality Score218.009
Status Validated
Chromosome11
Chromosomal Location58104153-58118594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58117505 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 266 (V266L)
Ref Sequence ENSEMBL: ENSMUSP00000104471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020822] [ENSMUST00000035604] [ENSMUST00000102711] [ENSMUST00000108843] [ENSMUST00000172035]
Predicted Effect probably benign
Transcript: ENSMUST00000020822
AA Change: V266L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020822
Gene: ENSMUSG00000020515
AA Change: V266L

DomainStartEndE-ValueType
Pfam:CAF1 15 139 4.3e-15 PFAM
Pfam:CAF1 138 238 1.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035604
SMART Domains Protein: ENSMUSP00000036603
Gene: ENSMUSG00000037275

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102711
SMART Domains Protein: ENSMUSP00000099772
Gene: ENSMUSG00000037275

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1063 1083 N/A INTRINSIC
low complexity region 1116 1131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108843
AA Change: V266L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104471
Gene: ENSMUSG00000020515
AA Change: V266L

DomainStartEndE-ValueType
Pfam:CAF1 13 240 1.3e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172035
SMART Domains Protein: ENSMUSP00000131842
Gene: ENSMUSG00000037275

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.0%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 C A 9: 90,191,804 probably null Het
Adcy4 T C 14: 55,778,391 T414A possibly damaging Het
Bop1 A G 15: 76,453,988 F561L probably damaging Het
Ccdc18 T C 5: 108,161,535 V332A probably benign Het
Cep290 A G 10: 100,530,056 T1042A probably damaging Het
Cxxc4 C T 3: 134,240,516 S286F possibly damaging Het
Cyp2d12 A T 15: 82,559,047 I386L probably benign Het
Dgka A T 10: 128,733,015 I227N probably damaging Het
Eif2d T C 1: 131,164,667 V354A probably benign Het
Fgr T A 4: 132,995,069 probably null Het
Idnk A G 13: 58,160,241 probably null Het
Kmt2e T C 5: 23,497,545 S952P probably damaging Het
Kng1 A G 16: 23,077,374 H343R probably benign Het
Lgals8 G A 13: 12,454,801 probably benign Het
Lrit3 T A 3: 129,789,234 Q368L probably benign Het
Lypd8 A T 11: 58,382,766 T24S probably benign Het
Map3k4 G A 17: 12,260,569 Q704* probably null Het
Mcm3ap A G 10: 76,515,666 I1948V probably benign Het
Mettl25 A G 10: 105,826,192 F306L probably benign Het
Mos A C 4: 3,871,585 V77G probably damaging Het
Muc4 C T 16: 32,775,803 R3130C possibly damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nup107 A G 10: 117,757,274 V833A probably benign Het
Olfr1022 T C 2: 85,868,927 F112L probably benign Het
Olfr409-ps1 C T 11: 74,317,544 S173L unknown Het
Pcnx2 C T 8: 125,850,282 probably null Het
Pde10a T A 17: 8,969,592 I908N probably damaging Het
Plcb1 A G 2: 135,386,155 K1058R probably benign Het
Rad17 A T 13: 100,622,875 F548Y probably damaging Het
Rad54b T G 4: 11,569,859 S58R possibly damaging Het
Rbm20 G A 19: 53,851,265 G895D probably damaging Het
Rgs22 T C 15: 36,103,890 probably null Het
Rhobtb3 A G 13: 75,910,666 S338P probably benign Het
Ruvbl2 A G 7: 45,424,949 probably null Het
Slc16a12 A G 19: 34,672,607 F343L probably benign Het
Slc22a28 A G 19: 8,064,510 L444P possibly damaging Het
Slc44a4 A T 17: 34,928,068 Q358L probably null Het
Sowaha A G 11: 53,478,398 F504L probably benign Het
Syne1 A G 10: 5,175,789 L6035P probably damaging Het
Thbs2 A T 17: 14,689,767 M190K possibly damaging Het
Tmem171 A G 13: 98,688,442 F227L possibly damaging Het
Trp53 A G 11: 69,588,481 K162E possibly damaging Het
Ttn T A 2: 76,894,388 K2098* probably null Het
Usp30 T C 5: 114,103,760 S88P probably benign Het
Zfp276 C A 8: 123,254,904 D63E probably benign Het
Other mutations in Cnot8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Cnot8 APN 11 58111362 missense probably damaging 1.00
IGL01774:Cnot8 APN 11 58115307 missense probably benign 0.01
IGL02877:Cnot8 APN 11 58111402 missense probably benign 0.01
straws UTSW 11 58114065 missense probably damaging 1.00
R0465:Cnot8 UTSW 11 58114060 missense probably damaging 0.99
R1802:Cnot8 UTSW 11 58117535 missense probably benign 0.01
R2418:Cnot8 UTSW 11 58115310 missense probably damaging 1.00
R2419:Cnot8 UTSW 11 58115310 missense probably damaging 1.00
R5199:Cnot8 UTSW 11 58115274 nonsense probably null
R5257:Cnot8 UTSW 11 58117522 missense possibly damaging 0.94
R5317:Cnot8 UTSW 11 58113203 missense probably damaging 1.00
R5351:Cnot8 UTSW 11 58115321 missense probably damaging 1.00
R5702:Cnot8 UTSW 11 58114047 missense possibly damaging 0.71
R6106:Cnot8 UTSW 11 58113990 missense probably damaging 0.96
R6261:Cnot8 UTSW 11 58114051 missense probably damaging 1.00
R6419:Cnot8 UTSW 11 58114065 missense probably damaging 1.00
R7070:Cnot8 UTSW 11 58117452 missense probably benign 0.00
R7888:Cnot8 UTSW 11 58111311 missense probably benign
R7971:Cnot8 UTSW 11 58111311 missense probably benign
Z1176:Cnot8 UTSW 11 58113090 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CGGGATGTGTACAATGGAGC -3'
(R):5'- CCTCCTGGATCTAAAATAAAGGCATC -3'

Sequencing Primer
(F):5'- TGTGTACAATGGAGCAGAAAACGTC -3'
(R):5'- CTTTAAACAAAAAGCCAAAGTCTCTG -3'
Posted On2018-11-28