Incidental Mutation 'R6947:Lgals8'
ID540939
Institutional Source Beutler Lab
Gene Symbol Lgals8
Ensembl Gene ENSMUSG00000057554
Gene Namelectin, galactose binding, soluble 8
SynonymsLgals-8, 1200015E08Rik, D13Ertd524e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6947 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location12439415-12464944 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to A at 12454801 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099820] [ENSMUST00000099821] [ENSMUST00000124888] [ENSMUST00000135166] [ENSMUST00000143693] [ENSMUST00000144283]
Predicted Effect silent
Transcript: ENSMUST00000099820
SMART Domains Protein: ENSMUSP00000097408
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect silent
Transcript: ENSMUST00000099821
SMART Domains Protein: ENSMUSP00000097409
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect silent
Transcript: ENSMUST00000124888
SMART Domains Protein: ENSMUSP00000115094
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135166
SMART Domains Protein: ENSMUSP00000120210
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
Pfam:Gal-bind_lectin 1 57 4e-16 PFAM
GLECT 91 223 1.38e-48 SMART
Gal-bind_lectin 97 222 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143693
SMART Domains Protein: ENSMUSP00000118925
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
Pfam:Gal-bind_lectin 1 57 4e-16 PFAM
GLECT 91 223 1.38e-48 SMART
Gal-bind_lectin 97 222 1.28e-49 SMART
Predicted Effect silent
Transcript: ENSMUST00000144283
SMART Domains Protein: ENSMUSP00000114200
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 193 325 1.38e-48 SMART
Gal-bind_lectin 199 324 1.28e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the galectin family. Galectins are beta-galactoside-binding animal lectins with conserved carbohydrate recognition domains. The galectins have been implicated in many essential functions including development, differentiation, cell-cell adhesion, cell-matrix interaction, growth regulation, apoptosis, and RNA splicing. This gene is widely expressed in tumoral tissues and seems to be involved in integrin-like cell interactions. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced VEGF-C-induced lymphangiogenesis, and ameliorated corneal pathology and lymphangiogenesis in a model of herpes simplex virus keratitis. Mice homozygous for a gene trapped allele exhibit hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 C A 9: 90,191,804 probably null Het
Adcy4 T C 14: 55,778,391 T414A possibly damaging Het
Bop1 A G 15: 76,453,988 F561L probably damaging Het
Ccdc18 T C 5: 108,161,535 V332A probably benign Het
Cep290 A G 10: 100,530,056 T1042A probably damaging Het
Cnot8 G T 11: 58,117,505 V266L probably benign Het
Cxxc4 C T 3: 134,240,516 S286F possibly damaging Het
Cyp2d12 A T 15: 82,559,047 I386L probably benign Het
Dgka A T 10: 128,733,015 I227N probably damaging Het
Eif2d T C 1: 131,164,667 V354A probably benign Het
Fgr T A 4: 132,995,069 probably null Het
Idnk A G 13: 58,160,241 probably null Het
Kmt2e T C 5: 23,497,545 S952P probably damaging Het
Kng1 A G 16: 23,077,374 H343R probably benign Het
Lrit3 T A 3: 129,789,234 Q368L probably benign Het
Lypd8 A T 11: 58,382,766 T24S probably benign Het
Map3k4 G A 17: 12,260,569 Q704* probably null Het
Mcm3ap A G 10: 76,515,666 I1948V probably benign Het
Mettl25 A G 10: 105,826,192 F306L probably benign Het
Mos A C 4: 3,871,585 V77G probably damaging Het
Muc4 C T 16: 32,775,803 R3130C possibly damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nup107 A G 10: 117,757,274 V833A probably benign Het
Olfr1022 T C 2: 85,868,927 F112L probably benign Het
Olfr409-ps1 C T 11: 74,317,544 S173L unknown Het
Pcnx2 C T 8: 125,850,282 probably null Het
Pde10a T A 17: 8,969,592 I908N probably damaging Het
Plcb1 A G 2: 135,386,155 K1058R probably benign Het
Rad17 A T 13: 100,622,875 F548Y probably damaging Het
Rad54b T G 4: 11,569,859 S58R possibly damaging Het
Rbm20 G A 19: 53,851,265 G895D probably damaging Het
Rgs22 T C 15: 36,103,890 probably null Het
Rhobtb3 A G 13: 75,910,666 S338P probably benign Het
Ruvbl2 A G 7: 45,424,949 probably null Het
Slc16a12 A G 19: 34,672,607 F343L probably benign Het
Slc22a28 A G 19: 8,064,510 L444P possibly damaging Het
Slc44a4 A T 17: 34,928,068 Q358L probably null Het
Sowaha A G 11: 53,478,398 F504L probably benign Het
Syne1 A G 10: 5,175,789 L6035P probably damaging Het
Thbs2 A T 17: 14,689,767 M190K possibly damaging Het
Tmem171 A G 13: 98,688,442 F227L possibly damaging Het
Trp53 A G 11: 69,588,481 K162E possibly damaging Het
Ttn T A 2: 76,894,388 K2098* probably null Het
Usp30 T C 5: 114,103,760 S88P probably benign Het
Zfp276 C A 8: 123,254,904 D63E probably benign Het
Other mutations in Lgals8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01601:Lgals8 APN 13 12456338 splice site probably benign
IGL02407:Lgals8 APN 13 12454818 missense probably benign 0.01
R0015:Lgals8 UTSW 13 12447298 missense probably damaging 1.00
R0015:Lgals8 UTSW 13 12447298 missense probably damaging 1.00
R0973:Lgals8 UTSW 13 12451395 splice site probably benign
R1452:Lgals8 UTSW 13 12453327 nonsense probably null
R1748:Lgals8 UTSW 13 12454943 missense probably damaging 1.00
R1939:Lgals8 UTSW 13 12459188 missense probably benign 0.00
R2076:Lgals8 UTSW 13 12454869 nonsense probably null
R2214:Lgals8 UTSW 13 12454832 missense probably benign 0.02
R4568:Lgals8 UTSW 13 12453373 missense probably damaging 1.00
R4791:Lgals8 UTSW 13 12453322 missense possibly damaging 0.94
R5243:Lgals8 UTSW 13 12454764 missense probably benign 0.27
R7476:Lgals8 UTSW 13 12448481 missense probably damaging 0.97
R7515:Lgals8 UTSW 13 12448462 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACAGTGACACGATGCTGTGG -3'
(R):5'- AGGCTCACATGGTTCTGTTCTG -3'

Sequencing Primer
(F):5'- GTCCAGAATTTAGCGCTCCTAGAAG -3'
(R):5'- ACATGGTTCTGTTCTGCCCTCG -3'
Posted On2018-11-28