Incidental Mutation 'R6947:Tmem171'
ID540941
Institutional Source Beutler Lab
Gene Symbol Tmem171
Ensembl Gene ENSMUSG00000052485
Gene Nametransmembrane protein 171
SynonymsLOC380863
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6947 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location98686235-98694834 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98688442 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 227 (F227L)
Ref Sequence ENSEMBL: ENSMUSP00000070369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064347] [ENSMUST00000148950]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064347
AA Change: F227L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070369
Gene: ENSMUSG00000052485
AA Change: F227L

DomainStartEndE-ValueType
Pfam:TMEM171 2 317 3e-168 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148950
SMART Domains Protein: ENSMUSP00000121382
Gene: ENSMUSG00000052485

DomainStartEndE-ValueType
Pfam:TMEM171 2 109 1e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.0%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 C A 9: 90,191,804 probably null Het
Adcy4 T C 14: 55,778,391 T414A possibly damaging Het
Bop1 A G 15: 76,453,988 F561L probably damaging Het
Ccdc18 T C 5: 108,161,535 V332A probably benign Het
Cep290 A G 10: 100,530,056 T1042A probably damaging Het
Cnot8 G T 11: 58,117,505 V266L probably benign Het
Cxxc4 C T 3: 134,240,516 S286F possibly damaging Het
Cyp2d12 A T 15: 82,559,047 I386L probably benign Het
Dgka A T 10: 128,733,015 I227N probably damaging Het
Eif2d T C 1: 131,164,667 V354A probably benign Het
Fgr T A 4: 132,995,069 probably null Het
Idnk A G 13: 58,160,241 probably null Het
Kmt2e T C 5: 23,497,545 S952P probably damaging Het
Kng1 A G 16: 23,077,374 H343R probably benign Het
Lgals8 G A 13: 12,454,801 probably benign Het
Lrit3 T A 3: 129,789,234 Q368L probably benign Het
Lypd8 A T 11: 58,382,766 T24S probably benign Het
Map3k4 G A 17: 12,260,569 Q704* probably null Het
Mcm3ap A G 10: 76,515,666 I1948V probably benign Het
Mettl25 A G 10: 105,826,192 F306L probably benign Het
Mos A C 4: 3,871,585 V77G probably damaging Het
Muc4 C T 16: 32,775,803 R3130C possibly damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nup107 A G 10: 117,757,274 V833A probably benign Het
Olfr1022 T C 2: 85,868,927 F112L probably benign Het
Olfr409-ps1 C T 11: 74,317,544 S173L unknown Het
Pcnx2 C T 8: 125,850,282 probably null Het
Pde10a T A 17: 8,969,592 I908N probably damaging Het
Plcb1 A G 2: 135,386,155 K1058R probably benign Het
Rad17 A T 13: 100,622,875 F548Y probably damaging Het
Rad54b T G 4: 11,569,859 S58R possibly damaging Het
Rbm20 G A 19: 53,851,265 G895D probably damaging Het
Rgs22 T C 15: 36,103,890 probably null Het
Rhobtb3 A G 13: 75,910,666 S338P probably benign Het
Ruvbl2 A G 7: 45,424,949 probably null Het
Slc16a12 A G 19: 34,672,607 F343L probably benign Het
Slc22a28 A G 19: 8,064,510 L444P possibly damaging Het
Slc44a4 A T 17: 34,928,068 Q358L probably null Het
Sowaha A G 11: 53,478,398 F504L probably benign Het
Syne1 A G 10: 5,175,789 L6035P probably damaging Het
Thbs2 A T 17: 14,689,767 M190K possibly damaging Het
Trp53 A G 11: 69,588,481 K162E possibly damaging Het
Ttn T A 2: 76,894,388 K2098* probably null Het
Usp30 T C 5: 114,103,760 S88P probably benign Het
Zfp276 C A 8: 123,254,904 D63E probably benign Het
Other mutations in Tmem171
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Tmem171 APN 13 98686426 missense probably benign
IGL01024:Tmem171 APN 13 98686518 critical splice acceptor site probably null
IGL01584:Tmem171 APN 13 98692175 unclassified probably null
R0366:Tmem171 UTSW 13 98692228 missense possibly damaging 0.92
R0380:Tmem171 UTSW 13 98692027 missense possibly damaging 0.75
R1903:Tmem171 UTSW 13 98686416 nonsense probably null
R2023:Tmem171 UTSW 13 98692225 missense probably damaging 0.97
R2102:Tmem171 UTSW 13 98692343 missense probably damaging 1.00
R4090:Tmem171 UTSW 13 98692588 missense probably damaging 0.99
R4941:Tmem171 UTSW 13 98692295 missense possibly damaging 0.92
R5341:Tmem171 UTSW 13 98688448 missense probably damaging 1.00
R5654:Tmem171 UTSW 13 98692066 missense probably benign 0.12
R5741:Tmem171 UTSW 13 98692051 missense probably benign
R5761:Tmem171 UTSW 13 98692511 missense probably damaging 1.00
R6725:Tmem171 UTSW 13 98692170 nonsense probably null
R6981:Tmem171 UTSW 13 98692468 missense possibly damaging 0.92
R7171:Tmem171 UTSW 13 98692236 nonsense probably null
R7229:Tmem171 UTSW 13 98692625 missense probably benign 0.23
R7447:Tmem171 UTSW 13 98688354 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCGGGATCTCAAACATG -3'
(R):5'- ACTTGACATGGAACTGTCGC -3'

Sequencing Primer
(F):5'- GCCTTAAAAGTGACACTGGCCTG -3'
(R):5'- TGACATGGAACTGTCGCAGGTC -3'
Posted On2018-11-28