Incidental Mutation 'R6947:Adcy4'
ID540943
Institutional Source Beutler Lab
Gene Symbol Adcy4
Ensembl Gene ENSMUSG00000022220
Gene Nameadenylate cyclase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6947 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55769057-55784095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55778391 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 414 (T414A)
Ref Sequence ENSEMBL: ENSMUSP00000130530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002398] [ENSMUST00000170223]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002398
AA Change: T414A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002398
Gene: ENSMUSG00000022220
AA Change: T414A

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 66 80 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 2.4e-35 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170223
AA Change: T414A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130530
Gene: ENSMUSG00000022220
AA Change: T414A

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 61 80 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 119 138 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 172 194 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 1.6e-24 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Meta Mutation Damage Score 0.7760 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). Mouse studies show that adenylate cyclase 4, along with adenylate cyclases 2 and 3, is expressed in olfactory cilia, suggesting that several different adenylate cyclases may couple to olfactory receptors and that there may be multiple receptor-mediated mechanisms for the generation of cAMP signals. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 C A 9: 90,191,804 probably null Het
Bop1 A G 15: 76,453,988 F561L probably damaging Het
Ccdc18 T C 5: 108,161,535 V332A probably benign Het
Cep290 A G 10: 100,530,056 T1042A probably damaging Het
Cnot8 G T 11: 58,117,505 V266L probably benign Het
Cxxc4 C T 3: 134,240,516 S286F possibly damaging Het
Cyp2d12 A T 15: 82,559,047 I386L probably benign Het
Dgka A T 10: 128,733,015 I227N probably damaging Het
Eif2d T C 1: 131,164,667 V354A probably benign Het
Fgr T A 4: 132,995,069 probably null Het
Idnk A G 13: 58,160,241 probably null Het
Kmt2e T C 5: 23,497,545 S952P probably damaging Het
Kng1 A G 16: 23,077,374 H343R probably benign Het
Lgals8 G A 13: 12,454,801 probably benign Het
Lrit3 T A 3: 129,789,234 Q368L probably benign Het
Lypd8 A T 11: 58,382,766 T24S probably benign Het
Map3k4 G A 17: 12,260,569 Q704* probably null Het
Mcm3ap A G 10: 76,515,666 I1948V probably benign Het
Mettl25 A G 10: 105,826,192 F306L probably benign Het
Mos A C 4: 3,871,585 V77G probably damaging Het
Muc4 C T 16: 32,775,803 R3130C possibly damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nup107 A G 10: 117,757,274 V833A probably benign Het
Olfr1022 T C 2: 85,868,927 F112L probably benign Het
Olfr409-ps1 C T 11: 74,317,544 S173L unknown Het
Pcnx2 C T 8: 125,850,282 probably null Het
Pde10a T A 17: 8,969,592 I908N probably damaging Het
Plcb1 A G 2: 135,386,155 K1058R probably benign Het
Rad17 A T 13: 100,622,875 F548Y probably damaging Het
Rad54b T G 4: 11,569,859 S58R possibly damaging Het
Rbm20 G A 19: 53,851,265 G895D probably damaging Het
Rgs22 T C 15: 36,103,890 probably null Het
Rhobtb3 A G 13: 75,910,666 S338P probably benign Het
Ruvbl2 A G 7: 45,424,949 probably null Het
Slc16a12 A G 19: 34,672,607 F343L probably benign Het
Slc22a28 A G 19: 8,064,510 L444P possibly damaging Het
Slc44a4 A T 17: 34,928,068 Q358L probably null Het
Sowaha A G 11: 53,478,398 F504L probably benign Het
Syne1 A G 10: 5,175,789 L6035P probably damaging Het
Thbs2 A T 17: 14,689,767 M190K possibly damaging Het
Tmem171 A G 13: 98,688,442 F227L possibly damaging Het
Trp53 A G 11: 69,588,481 K162E possibly damaging Het
Ttn T A 2: 76,894,388 K2098* probably null Het
Usp30 T C 5: 114,103,760 S88P probably benign Het
Zfp276 C A 8: 123,254,904 D63E probably benign Het
Other mutations in Adcy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Adcy4 APN 14 55773663 splice site probably null
IGL02406:Adcy4 APN 14 55770047 missense possibly damaging 0.45
IGL02503:Adcy4 APN 14 55771505 missense probably damaging 1.00
IGL02543:Adcy4 APN 14 55769170 missense probably benign
IGL02616:Adcy4 APN 14 55783514 unclassified probably null
IGL03002:Adcy4 APN 14 55773556 missense probably benign 0.31
IGL03026:Adcy4 APN 14 55778010 missense probably damaging 1.00
IGL03190:Adcy4 APN 14 55779053 missense probably damaging 1.00
IGL03247:Adcy4 APN 14 55770096 missense probably damaging 1.00
stressed UTSW 14 55779099 intron probably null
IGL03098:Adcy4 UTSW 14 55781581 missense probably null 0.82
R0098:Adcy4 UTSW 14 55769827 missense possibly damaging 0.78
R0102:Adcy4 UTSW 14 55771533 missense probably benign 0.29
R0396:Adcy4 UTSW 14 55772288 missense probably benign 0.00
R0482:Adcy4 UTSW 14 55774572 critical splice acceptor site probably null
R0634:Adcy4 UTSW 14 55781597 missense probably benign
R0691:Adcy4 UTSW 14 55772647 splice site probably benign
R0704:Adcy4 UTSW 14 55772756 missense probably benign
R0815:Adcy4 UTSW 14 55783599 missense probably damaging 1.00
R0863:Adcy4 UTSW 14 55783599 missense probably damaging 1.00
R1446:Adcy4 UTSW 14 55770023 critical splice donor site probably null
R1462:Adcy4 UTSW 14 55778308 missense possibly damaging 0.78
R1462:Adcy4 UTSW 14 55778308 missense possibly damaging 0.78
R1463:Adcy4 UTSW 14 55778939 missense probably damaging 1.00
R1624:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R1799:Adcy4 UTSW 14 55771472 missense probably benign 0.01
R1878:Adcy4 UTSW 14 55769905 missense probably damaging 0.96
R2007:Adcy4 UTSW 14 55778313 missense possibly damaging 0.45
R2156:Adcy4 UTSW 14 55769170 missense probably benign 0.09
R2425:Adcy4 UTSW 14 55778017 missense probably damaging 0.99
R2517:Adcy4 UTSW 14 55781946 missense probably damaging 1.00
R3882:Adcy4 UTSW 14 55774546 missense probably benign 0.27
R4021:Adcy4 UTSW 14 55775178 intron probably null
R4022:Adcy4 UTSW 14 55775178 intron probably null
R4411:Adcy4 UTSW 14 55769443 missense probably damaging 1.00
R4530:Adcy4 UTSW 14 55779028 missense probably damaging 1.00
R4560:Adcy4 UTSW 14 55778950 unclassified probably null
R4704:Adcy4 UTSW 14 55775025 missense possibly damaging 0.91
R4780:Adcy4 UTSW 14 55775036 missense probably benign 0.07
R4860:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R4860:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R4868:Adcy4 UTSW 14 55773722 missense probably benign
R4890:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4920:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4948:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4952:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4953:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4987:Adcy4 UTSW 14 55773477 missense probably benign 0.01
R4991:Adcy4 UTSW 14 55773465 missense probably benign 0.03
R5080:Adcy4 UTSW 14 55772375 missense probably damaging 0.98
R5620:Adcy4 UTSW 14 55772367 nonsense probably null
R5652:Adcy4 UTSW 14 55773443 missense probably benign
R5726:Adcy4 UTSW 14 55783661 missense probably damaging 1.00
R5910:Adcy4 UTSW 14 55779013 missense probably damaging 1.00
R5958:Adcy4 UTSW 14 55779099 intron probably null
R6280:Adcy4 UTSW 14 55779043 missense probably damaging 1.00
R6318:Adcy4 UTSW 14 55769224 missense probably damaging 1.00
R6598:Adcy4 UTSW 14 55770045 missense probably benign 0.03
R7012:Adcy4 UTSW 14 55779919 missense possibly damaging 0.95
R7147:Adcy4 UTSW 14 55779725 missense probably damaging 1.00
R7386:Adcy4 UTSW 14 55778327 missense probably damaging 1.00
R7414:Adcy4 UTSW 14 55781633 missense probably benign 0.15
R7431:Adcy4 UTSW 14 55772672 missense probably benign 0.01
R7490:Adcy4 UTSW 14 55770433 missense possibly damaging 0.66
R7552:Adcy4 UTSW 14 55773465 missense probably benign 0.00
R7672:Adcy4 UTSW 14 55780905 missense probably benign 0.14
R8003:Adcy4 UTSW 14 55781635 missense probably benign 0.00
R8042:Adcy4 UTSW 14 55775239 missense probably benign 0.01
R8100:Adcy4 UTSW 14 55772265 nonsense probably null
X0025:Adcy4 UTSW 14 55770391 missense probably damaging 1.00
Z1088:Adcy4 UTSW 14 55780956 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GAAAAGGCTGGCTTTGTTGAC -3'
(R):5'- AATGGCCGGTTGAGTCTCTC -3'

Sequencing Primer
(F):5'- ACTAGGTGGTCTGCTTGGTCTAATC -3'
(R):5'- GTTCACAGTCCCTTCAGACAAGTG -3'
Posted On2018-11-28