Incidental Mutation 'R6947:Bop1'
ID540945
Institutional Source Beutler Lab
Gene Symbol Bop1
Ensembl Gene ENSMUSG00000022557
Gene Nameblock of proliferation 1
SynonymsErb1p
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R6947 (G1)
Quality Score131.008
Status Validated
Chromosome15
Chromosomal Location76452989-76477277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76453988 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 561 (F561L)
Ref Sequence ENSEMBL: ENSMUSP00000023217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023217] [ENSMUST00000043089] [ENSMUST00000096385]
Predicted Effect probably damaging
Transcript: ENSMUST00000023217
AA Change: F561L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023217
Gene: ENSMUSG00000022557
AA Change: F561L

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
BOP1NT 130 388 1.38e-177 SMART
WD40 388 427 1.16e-9 SMART
WD40 430 469 6.16e0 SMART
WD40 508 551 7.1e1 SMART
WD40 554 592 4.46e-1 SMART
WD40 595 634 2.76e-2 SMART
WD40 638 677 4.14e-6 SMART
WD40 689 732 3.14e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043089
SMART Domains Protein: ENSMUSP00000043668
Gene: ENSMUSG00000034161

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
low complexity region 45 80 N/A INTRINSIC
HLH 84 136 1.46e-16 SMART
low complexity region 161 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096385
SMART Domains Protein: ENSMUSP00000094115
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 799 810 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1488 1502 N/A INTRINSIC
Pfam:HEAT 1610 1640 2.2e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161265
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.0%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 C A 9: 90,191,804 probably null Het
Adcy4 T C 14: 55,778,391 T414A possibly damaging Het
Ccdc18 T C 5: 108,161,535 V332A probably benign Het
Cep290 A G 10: 100,530,056 T1042A probably damaging Het
Cnot8 G T 11: 58,117,505 V266L probably benign Het
Cxxc4 C T 3: 134,240,516 S286F possibly damaging Het
Cyp2d12 A T 15: 82,559,047 I386L probably benign Het
Dgka A T 10: 128,733,015 I227N probably damaging Het
Eif2d T C 1: 131,164,667 V354A probably benign Het
Fgr T A 4: 132,995,069 probably null Het
Idnk A G 13: 58,160,241 probably null Het
Kmt2e T C 5: 23,497,545 S952P probably damaging Het
Kng1 A G 16: 23,077,374 H343R probably benign Het
Lgals8 G A 13: 12,454,801 probably benign Het
Lrit3 T A 3: 129,789,234 Q368L probably benign Het
Lypd8 A T 11: 58,382,766 T24S probably benign Het
Map3k4 G A 17: 12,260,569 Q704* probably null Het
Mcm3ap A G 10: 76,515,666 I1948V probably benign Het
Mettl25 A G 10: 105,826,192 F306L probably benign Het
Mos A C 4: 3,871,585 V77G probably damaging Het
Muc4 C T 16: 32,775,803 R3130C possibly damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nup107 A G 10: 117,757,274 V833A probably benign Het
Olfr1022 T C 2: 85,868,927 F112L probably benign Het
Olfr409-ps1 C T 11: 74,317,544 S173L unknown Het
Pcnx2 C T 8: 125,850,282 probably null Het
Pde10a T A 17: 8,969,592 I908N probably damaging Het
Plcb1 A G 2: 135,386,155 K1058R probably benign Het
Rad17 A T 13: 100,622,875 F548Y probably damaging Het
Rad54b T G 4: 11,569,859 S58R possibly damaging Het
Rbm20 G A 19: 53,851,265 G895D probably damaging Het
Rgs22 T C 15: 36,103,890 probably null Het
Rhobtb3 A G 13: 75,910,666 S338P probably benign Het
Ruvbl2 A G 7: 45,424,949 probably null Het
Slc16a12 A G 19: 34,672,607 F343L probably benign Het
Slc22a28 A G 19: 8,064,510 L444P possibly damaging Het
Slc44a4 A T 17: 34,928,068 Q358L probably null Het
Sowaha A G 11: 53,478,398 F504L probably benign Het
Syne1 A G 10: 5,175,789 L6035P probably damaging Het
Thbs2 A T 17: 14,689,767 M190K possibly damaging Het
Tmem171 A G 13: 98,688,442 F227L possibly damaging Het
Trp53 A G 11: 69,588,481 K162E possibly damaging Het
Ttn T A 2: 76,894,388 K2098* probably null Het
Usp30 T C 5: 114,103,760 S88P probably benign Het
Zfp276 C A 8: 123,254,904 D63E probably benign Het
Other mutations in Bop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Bop1 APN 15 76454528 missense probably benign 0.04
IGL01085:Bop1 APN 15 76453376 missense probably damaging 1.00
IGL02157:Bop1 APN 15 76455572 missense possibly damaging 0.70
R0332:Bop1 UTSW 15 76455987 missense probably damaging 1.00
R2148:Bop1 UTSW 15 76455287 missense probably damaging 0.96
R3979:Bop1 UTSW 15 76453876 missense probably damaging 1.00
R4133:Bop1 UTSW 15 76454335 missense probably benign 0.24
R5396:Bop1 UTSW 15 76455289 missense probably damaging 1.00
R5434:Bop1 UTSW 15 76455411 missense probably benign 0.01
R5666:Bop1 UTSW 15 76454233 missense probably benign 0.00
R5820:Bop1 UTSW 15 76454841 missense probably damaging 1.00
R5883:Bop1 UTSW 15 76454849 missense probably damaging 1.00
R5907:Bop1 UTSW 15 76455917 missense probably damaging 1.00
R6807:Bop1 UTSW 15 76454983 missense probably damaging 0.99
R7232:Bop1 UTSW 15 76453346 missense probably damaging 1.00
R7395:Bop1 UTSW 15 76453841 missense probably damaging 1.00
R7477:Bop1 UTSW 15 76455326 missense probably damaging 1.00
R7725:Bop1 UTSW 15 76455383 missense probably benign 0.23
R7792:Bop1 UTSW 15 76454348 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGCACAGGGTTCACTCC -3'
(R):5'- CCACAGCAAAGTATGTGATGGG -3'

Sequencing Primer
(F):5'- ACTCCCCTACCCTGATGTGGAG -3'
(R):5'- CAAAGTATGTGATGGGACGGG -3'
Posted On2018-11-28