Mutagenetix > Incidental Mutation

Incidental Mutation 'R6948:Mtor'

540963

Institutional Source

Beutler Lab

Gene Symbol

Mtor

Ensembl Gene

ENSMUSG00000028991

Gene Name

mechanistic target of rapamycin kinase

Synonyms

flat, 2610315D21Rik, RAPT1, RAFT1, mechanistic target of rapamycin (serine/threonine kinase), FKBP-rapamycin-associated protein FRAP, Frap1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6948 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

148533068-148642140 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 148621209 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 1869 (V1869G)

Ref Sequence

ENSEMBL: ENSMUSP00000099510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103221]

AlphaFold

Q9JLN9

Predicted Effect

probably benign
Transcript: ENSMUST00000103221
AA Change: V1869G

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: V1869G

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	179	191	N/A	INTRINSIC
low complexity region	277	288	N/A	INTRINSIC
low complexity region	774	790	N/A	INTRINSIC
DUF3385	854	1024	1.51e-93	SMART
low complexity region	1279	1300	N/A	INTRINSIC
Pfam:FAT	1513	1908	2.3e-134	PFAM
Rapamycin_bind	2015	2114	7.94e-61	SMART
PI3Kc	2183	2484	8.84e-121	SMART
FATC	2517	2549	2.11e-15	SMART

Meta Mutation Damage Score

0.1366

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arfgap2	A	G	2: 91,097,524 (GRCm39)	T107A	probably benign	Het
Calhm3	T	A	19: 47,140,344 (GRCm39)	M250L	probably damaging	Het
Catsperb	A	T	12: 101,447,327 (GRCm39)	I276L	probably benign	Het
Cd70	T	C	17: 57,456,594 (GRCm39)	E3G	probably damaging	Het
Cenpj	A	T	14: 56,790,683 (GRCm39)	S455R	probably damaging	Het
Cgn	C	G	3: 94,680,531 (GRCm39)	E590D	probably benign	Het
Cpvl	T	A	6: 53,873,468 (GRCm39)	I423F	possibly damaging	Het
Cyp2c54	T	A	19: 40,034,636 (GRCm39)	M345L	possibly damaging	Het
Dner	T	C	1: 84,383,738 (GRCm39)	N549D	probably damaging	Het
Fat4	T	A	3: 39,063,595 (GRCm39)	L4517Q	probably damaging	Het
Fbxw11	A	G	11: 32,692,597 (GRCm39)	T523A	probably damaging	Het
Flg	A	G	3: 93,195,475 (GRCm39)		probably benign	Het
Gcfc2	A	G	6: 81,910,734 (GRCm39)	E237G	probably benign	Het
Ipo5	G	T	14: 121,160,527 (GRCm39)	M181I	probably benign	Het
Itprid1	C	T	6: 55,955,470 (GRCm39)	T1026I	probably benign	Het
Klhl32	A	G	4: 24,629,250 (GRCm39)	Y506H	probably benign	Het
Mast3	G	A	8: 71,238,126 (GRCm39)	T505I	probably damaging	Het
Mrgprx2	A	T	7: 48,132,464 (GRCm39)	V118D	possibly damaging	Het
Mycbp2	A	T	14: 103,522,703 (GRCm39)	M720K	possibly damaging	Het
Npy4r	A	G	14: 33,868,731 (GRCm39)	Y186H	probably benign	Het
Obscn	A	G	11: 58,997,142 (GRCm39)	S1520P	probably damaging	Het
Or10g1b	A	T	14: 52,627,614 (GRCm39)	F205L	probably benign	Het
Pex1	A	G	5: 3,655,994 (GRCm39)	N274D	probably benign	Het
Plxnb1	T	C	9: 108,945,702 (GRCm39)	Y2078H	probably damaging	Het
Rasgrp1	T	C	2: 117,129,085 (GRCm39)	D178G	probably damaging	Het
Reln	A	G	5: 22,177,033 (GRCm39)	S1878P	probably damaging	Het
Rims2	T	C	15: 39,374,737 (GRCm39)	V1033A	probably benign	Het
Scaf1	G	T	7: 44,662,971 (GRCm39)	S14*	probably null	Het
Serpinb9d	A	G	13: 33,384,706 (GRCm39)	S228G	possibly damaging	Het
Slc22a14	C	A	9: 119,060,482 (GRCm39)	A93S	probably damaging	Het
Sox30	G	A	11: 45,908,166 (GRCm39)	V778M	probably damaging	Het
Tecrl	T	C	5: 83,457,097 (GRCm39)	I128V	probably benign	Het
Trip10	T	A	17: 57,569,448 (GRCm39)	C491S	probably damaging	Het
Vmn1r26	A	T	6: 57,985,718 (GRCm39)	M157K	probably damaging	Het
Zbtb1	A	T	12: 76,432,601 (GRCm39)	S196C	probably damaging	Het
Zfp236	T	C	18: 82,662,187 (GRCm39)	D582G	possibly damaging	Het
Zfp384	A	G	6: 125,001,873 (GRCm39)	T125A	probably benign	Het
Zpr1	T	G	9: 46,184,939 (GRCm39)		probably null	Het

Other mutations in Mtor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Mtor	APN	4	148,537,494 (GRCm39)	missense	probably benign	0.06
IGL01447:Mtor	APN	4	148,615,214 (GRCm39)	missense	possibly damaging	0.62
IGL01551:Mtor	APN	4	148,556,494 (GRCm39)	missense	probably damaging	0.99
IGL01661:Mtor	APN	4	148,599,308 (GRCm39)	missense	possibly damaging	0.61
IGL01675:Mtor	APN	4	148,569,111 (GRCm39)	missense	probably benign	0.00
IGL01743:Mtor	APN	4	148,615,070 (GRCm39)	splice site	probably benign
IGL02015:Mtor	APN	4	148,624,570 (GRCm39)	nonsense	probably null
IGL02084:Mtor	APN	4	148,555,137 (GRCm39)	missense	probably damaging	0.98
IGL02095:Mtor	APN	4	148,628,998 (GRCm39)	missense	probably damaging	1.00
IGL02129:Mtor	APN	4	148,634,302 (GRCm39)	missense	possibly damaging	0.91
IGL02260:Mtor	APN	4	148,622,758 (GRCm39)	missense	probably damaging	1.00
IGL02329:Mtor	APN	4	148,619,396 (GRCm39)	missense	probably benign	0.16
IGL02440:Mtor	APN	4	148,576,104 (GRCm39)	missense	probably benign	0.04
IGL02440:Mtor	APN	4	148,630,886 (GRCm39)	missense	probably benign	0.24
IGL02449:Mtor	APN	4	148,618,378 (GRCm39)	missense	possibly damaging	0.65
IGL02479:Mtor	APN	4	148,555,041 (GRCm39)	missense	probably damaging	1.00
IGL02904:Mtor	APN	4	148,576,069 (GRCm39)	splice site	probably benign
IGL02904:Mtor	APN	4	148,536,851 (GRCm39)	missense	possibly damaging	0.55
IGL02931:Mtor	APN	4	148,549,421 (GRCm39)	missense	probably benign	0.22
IGL03048:Mtor	APN	4	148,630,847 (GRCm39)	splice site	probably benign
IGL03133:Mtor	APN	4	148,568,776 (GRCm39)	missense	probably benign	0.01
IGL03142:Mtor	APN	4	148,538,356 (GRCm39)	missense	probably benign	0.00
Brushes	UTSW	4	148,548,205 (GRCm39)	missense	probably benign	0.00
Dynamo	UTSW	4	148,547,367 (GRCm39)	missense	probably benign	0.00
engine	UTSW	4	148,641,312 (GRCm39)	splice site	probably null
Erg	UTSW	4	148,630,053 (GRCm39)	missense	probably damaging	1.00
Lindor	UTSW	4	148,539,103 (GRCm39)	missense	probably damaging	1.00
motor	UTSW	4	148,575,817 (GRCm39)	missense	possibly damaging	0.76
R4858_Mtor_211	UTSW	4	148,539,273 (GRCm39)	makesense	probably null
Vigor	UTSW	4	148,623,356 (GRCm39)	missense	probably damaging	1.00
Vim	UTSW	4	148,610,260 (GRCm39)	critical splice donor site	probably null
PIT4519001:Mtor	UTSW	4	148,608,957 (GRCm39)	missense	probably damaging	1.00
R0045:Mtor	UTSW	4	148,549,406 (GRCm39)	missense	probably benign	0.42
R0048:Mtor	UTSW	4	148,623,338 (GRCm39)	nonsense	probably null
R0048:Mtor	UTSW	4	148,623,338 (GRCm39)	nonsense	probably null
R0103:Mtor	UTSW	4	148,618,359 (GRCm39)	missense	probably benign	0.05
R0112:Mtor	UTSW	4	148,565,380 (GRCm39)	missense	probably damaging	1.00
R0137:Mtor	UTSW	4	148,555,081 (GRCm39)	missense	possibly damaging	0.78
R0184:Mtor	UTSW	4	148,549,428 (GRCm39)	missense	probably benign	0.05
R0208:Mtor	UTSW	4	148,549,432 (GRCm39)	missense	probably benign	0.43
R0329:Mtor	UTSW	4	148,568,837 (GRCm39)	missense	probably benign
R0330:Mtor	UTSW	4	148,568,837 (GRCm39)	missense	probably benign
R0365:Mtor	UTSW	4	148,570,507 (GRCm39)	missense	probably benign	0.01
R0537:Mtor	UTSW	4	148,622,817 (GRCm39)	missense	probably damaging	1.00
R0542:Mtor	UTSW	4	148,624,907 (GRCm39)	missense	probably benign	0.02
R0556:Mtor	UTSW	4	148,553,837 (GRCm39)	missense	possibly damaging	0.88
R0613:Mtor	UTSW	4	148,610,503 (GRCm39)	missense	possibly damaging	0.95
R0646:Mtor	UTSW	4	148,568,811 (GRCm39)	nonsense	probably null
R0710:Mtor	UTSW	4	148,548,848 (GRCm39)	missense	possibly damaging	0.73
R0791:Mtor	UTSW	4	148,547,367 (GRCm39)	missense	probably benign	0.00
R0792:Mtor	UTSW	4	148,547,367 (GRCm39)	missense	probably benign	0.00
R0866:Mtor	UTSW	4	148,570,513 (GRCm39)	missense	probably benign	0.04
R0973:Mtor	UTSW	4	148,634,645 (GRCm39)	missense	probably damaging	1.00
R1027:Mtor	UTSW	4	148,624,456 (GRCm39)	missense	probably benign	0.03
R1028:Mtor	UTSW	4	148,623,287 (GRCm39)	missense	possibly damaging	0.88
R1289:Mtor	UTSW	4	148,554,764 (GRCm39)	missense	probably benign	0.10
R1416:Mtor	UTSW	4	148,575,871 (GRCm39)	nonsense	probably null
R1465:Mtor	UTSW	4	148,610,450 (GRCm39)	splice site	probably benign
R1506:Mtor	UTSW	4	148,620,962 (GRCm39)	splice site	probably benign
R1624:Mtor	UTSW	4	148,632,133 (GRCm39)	missense	probably damaging	1.00
R1695:Mtor	UTSW	4	148,623,364 (GRCm39)	missense	probably benign	0.08
R1771:Mtor	UTSW	4	148,555,081 (GRCm39)	missense	possibly damaging	0.78
R1800:Mtor	UTSW	4	148,547,349 (GRCm39)	missense	probably benign	0.00
R1855:Mtor	UTSW	4	148,637,546 (GRCm39)	missense	probably benign	0.02
R1857:Mtor	UTSW	4	148,565,336 (GRCm39)	missense	probably damaging	1.00
R1867:Mtor	UTSW	4	148,539,089 (GRCm39)	missense	probably damaging	0.97
R1954:Mtor	UTSW	4	148,552,730 (GRCm39)	missense	probably damaging	1.00
R2054:Mtor	UTSW	4	148,550,482 (GRCm39)	missense	probably benign	0.00
R2054:Mtor	UTSW	4	148,547,309 (GRCm39)	missense	probably benign	0.05
R2099:Mtor	UTSW	4	148,634,649 (GRCm39)	nonsense	probably null
R2148:Mtor	UTSW	4	148,540,469 (GRCm39)	missense	possibly damaging	0.56
R2214:Mtor	UTSW	4	148,623,327 (GRCm39)	missense	probably benign	0.39
R2281:Mtor	UTSW	4	148,574,012 (GRCm39)	missense	probably benign	0.02
R2512:Mtor	UTSW	4	148,614,948 (GRCm39)	missense	possibly damaging	0.95
R2870:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2870:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2873:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R4032:Mtor	UTSW	4	148,621,209 (GRCm39)	missense	probably benign	0.03
R4073:Mtor	UTSW	4	148,633,832 (GRCm39)	missense	probably damaging	0.99
R4273:Mtor	UTSW	4	148,634,609 (GRCm39)	missense	probably benign	0.21
R4611:Mtor	UTSW	4	148,570,576 (GRCm39)	missense	probably benign	0.03
R4858:Mtor	UTSW	4	148,539,273 (GRCm39)	makesense	probably null
R4942:Mtor	UTSW	4	148,556,599 (GRCm39)	missense	probably benign	0.03
R4967:Mtor	UTSW	4	148,575,817 (GRCm39)	missense	possibly damaging	0.76
R4995:Mtor	UTSW	4	148,610,209 (GRCm39)	missense	probably damaging	1.00
R5054:Mtor	UTSW	4	148,641,312 (GRCm39)	splice site	probably null
R5215:Mtor	UTSW	4	148,538,440 (GRCm39)	missense	probably benign
R5249:Mtor	UTSW	4	148,548,189 (GRCm39)	missense	probably damaging	1.00
R5289:Mtor	UTSW	4	148,550,549 (GRCm39)	missense	possibly damaging	0.88
R5365:Mtor	UTSW	4	148,634,587 (GRCm39)	missense	probably damaging	0.99
R5498:Mtor	UTSW	4	148,624,821 (GRCm39)	missense	possibly damaging	0.71
R5514:Mtor	UTSW	4	148,630,901 (GRCm39)	missense	probably damaging	1.00
R5540:Mtor	UTSW	4	148,539,165 (GRCm39)	missense	probably benign	0.01
R5600:Mtor	UTSW	4	148,575,927 (GRCm39)	missense	probably damaging	1.00
R5615:Mtor	UTSW	4	148,622,733 (GRCm39)	missense	possibly damaging	0.95
R5632:Mtor	UTSW	4	148,553,463 (GRCm39)	missense	possibly damaging	0.94
R5641:Mtor	UTSW	4	148,630,882 (GRCm39)	missense	probably damaging	0.98
R5834:Mtor	UTSW	4	148,620,993 (GRCm39)	missense	possibly damaging	0.95
R5984:Mtor	UTSW	4	148,623,284 (GRCm39)	missense	probably benign	0.02
R6056:Mtor	UTSW	4	148,621,892 (GRCm39)	missense	probably benign	0.00
R6225:Mtor	UTSW	4	148,605,794 (GRCm39)	missense	probably benign	0.04
R6262:Mtor	UTSW	4	148,610,552 (GRCm39)	missense	possibly damaging	0.46
R6335:Mtor	UTSW	4	148,550,384 (GRCm39)	missense	probably damaging	1.00
R6479:Mtor	UTSW	4	148,635,457 (GRCm39)	missense	probably benign	0.16
R6543:Mtor	UTSW	4	148,630,053 (GRCm39)	missense	probably damaging	1.00
R6711:Mtor	UTSW	4	148,536,824 (GRCm39)	missense	possibly damaging	0.49
R6715:Mtor	UTSW	4	148,623,004 (GRCm39)	missense	probably benign	0.00
R6744:Mtor	UTSW	4	148,543,112 (GRCm39)	missense	probably benign	0.01
R6748:Mtor	UTSW	4	148,634,641 (GRCm39)	missense	probably damaging	1.00
R6762:Mtor	UTSW	4	148,622,938 (GRCm39)	missense	possibly damaging	0.47
R6836:Mtor	UTSW	4	148,573,955 (GRCm39)	missense	possibly damaging	0.94
R6979:Mtor	UTSW	4	148,608,930 (GRCm39)	missense	possibly damaging	0.60
R6992:Mtor	UTSW	4	148,548,932 (GRCm39)	missense	probably benign
R7271:Mtor	UTSW	4	148,630,942 (GRCm39)	missense	possibly damaging	0.70
R7423:Mtor	UTSW	4	148,640,801 (GRCm39)	missense	possibly damaging	0.77
R7434:Mtor	UTSW	4	148,549,416 (GRCm39)	missense	probably benign	0.39
R7619:Mtor	UTSW	4	148,547,252 (GRCm39)	missense	probably damaging	0.98
R7634:Mtor	UTSW	4	148,536,807 (GRCm39)	missense	possibly damaging	0.53
R7697:Mtor	UTSW	4	148,624,765 (GRCm39)	nonsense	probably null
R7737:Mtor	UTSW	4	148,623,195 (GRCm39)	missense	possibly damaging	0.95
R7791:Mtor	UTSW	4	148,547,397 (GRCm39)	missense	probably benign	0.00
R7858:Mtor	UTSW	4	148,539,103 (GRCm39)	missense	probably damaging	1.00
R8035:Mtor	UTSW	4	148,630,856 (GRCm39)	missense	probably benign	0.29
R8076:Mtor	UTSW	4	148,610,260 (GRCm39)	critical splice donor site	probably null
R8078:Mtor	UTSW	4	148,552,744 (GRCm39)	missense	probably benign
R8928:Mtor	UTSW	4	148,623,356 (GRCm39)	missense	probably damaging	1.00
R9040:Mtor	UTSW	4	148,548,205 (GRCm39)	missense	probably benign	0.00
R9116:Mtor	UTSW	4	148,637,198 (GRCm39)	missense	probably benign
R9284:Mtor	UTSW	4	148,543,537 (GRCm39)	missense	probably benign	0.03
R9310:Mtor	UTSW	4	148,553,834 (GRCm39)	missense	probably benign	0.03
R9374:Mtor	UTSW	4	148,599,397 (GRCm39)	missense	probably damaging	1.00
R9417:Mtor	UTSW	4	148,622,776 (GRCm39)	nonsense	probably null
R9465:Mtor	UTSW	4	148,624,839 (GRCm39)	missense	possibly damaging	0.92
R9492:Mtor	UTSW	4	148,568,801 (GRCm39)	missense	probably damaging	1.00
R9499:Mtor	UTSW	4	148,599,397 (GRCm39)	missense	probably damaging	1.00
R9516:Mtor	UTSW	4	148,569,103 (GRCm39)	missense	probably benign	0.23
R9600:Mtor	UTSW	4	148,632,092 (GRCm39)	missense	possibly damaging	0.82
R9622:Mtor	UTSW	4	148,568,169 (GRCm39)	missense	probably damaging	0.99
X0025:Mtor	UTSW	4	148,615,171 (GRCm39)	missense	probably benign	0.09
Z1176:Mtor	UTSW	4	148,634,587 (GRCm39)	missense	possibly damaging	0.69
Z1176:Mtor	UTSW	4	148,634,582 (GRCm39)	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- AGAACCAAGCCCGTGATGAG -3'
(R):5'- ATGTGCTCATTGCTGGGAGAAG -3'

Sequencing Primer
(F):5'- GAAGAAGAAGCTGCGTCATGCC -3'
(R):5'- AAGGAGCCTTGCTTCAGTCTGAC -3'

Posted On

2018-11-28