Incidental Mutation 'R6948:Tecrl'
ID540966
Institutional Source Beutler Lab
Gene Symbol Tecrl
Ensembl Gene ENSMUSG00000049537
Gene Nametrans-2,3-enoyl-CoA reductase-like
SynonymsSrd5a2l2, D330017N19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R6948 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location83278145-83355195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83309250 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 128 (I128V)
Ref Sequence ENSEMBL: ENSMUSP00000062122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053543]
Predicted Effect probably benign
Transcript: ENSMUST00000053543
AA Change: I128V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062122
Gene: ENSMUSG00000049537
AA Change: I128V

DomainStartEndE-ValueType
PDB:2DZJ|A 53 135 1e-17 PDB
Blast:UBQ 59 135 2e-7 BLAST
transmembrane domain 139 161 N/A INTRINSIC
Pfam:Steroid_dh 208 361 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146669
SMART Domains Protein: ENSMUSP00000115144
Gene: ENSMUSG00000049537

DomainStartEndE-ValueType
PDB:2DZJ|A 39 93 1e-11 PDB
transmembrane domain 100 122 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap2 A G 2: 91,267,179 T107A probably benign Het
Calhm3 T A 19: 47,151,905 M250L probably damaging Het
Catsperb A T 12: 101,481,068 I276L probably benign Het
Ccdc129 C T 6: 55,978,485 T1026I probably benign Het
Cd70 T C 17: 57,149,594 E3G probably damaging Het
Cenpj A T 14: 56,553,226 S455R probably damaging Het
Cgn C G 3: 94,773,221 E590D probably benign Het
Cpvl T A 6: 53,896,483 I423F possibly damaging Het
Cyp2c54 T A 19: 40,046,192 M345L possibly damaging Het
Dner T C 1: 84,406,017 N549D probably damaging Het
Fat4 T A 3: 39,009,446 L4517Q probably damaging Het
Fbxw11 A G 11: 32,742,597 T523A probably damaging Het
Flg A G 3: 93,288,168 probably benign Het
Gcfc2 A G 6: 81,933,753 E237G probably benign Het
Ipo5 G T 14: 120,923,115 M181I probably benign Het
Klhl32 A G 4: 24,629,250 Y506H probably benign Het
Mast3 G A 8: 70,785,482 T505I probably damaging Het
Mrgprx2 A T 7: 48,482,716 V118D possibly damaging Het
Mtor T G 4: 148,536,752 V1869G probably benign Het
Mycbp2 A T 14: 103,285,267 M720K possibly damaging Het
Npy4r A G 14: 34,146,774 Y186H probably benign Het
Obscn A G 11: 59,106,316 S1520P probably damaging Het
Olfr1511 A T 14: 52,390,157 F205L probably benign Het
Pex1 A G 5: 3,605,994 N274D probably benign Het
Plxnb1 T C 9: 109,116,634 Y2078H probably damaging Het
Rasgrp1 T C 2: 117,298,604 D178G probably damaging Het
Reln A G 5: 21,972,035 S1878P probably damaging Het
Rims2 T C 15: 39,511,341 V1033A probably benign Het
Scaf1 G T 7: 45,013,547 S14* probably null Het
Serpinb9d A G 13: 33,200,723 S228G possibly damaging Het
Slc22a14 C A 9: 119,231,416 A93S probably damaging Het
Sox30 G A 11: 46,017,339 V778M probably damaging Het
Trip10 T A 17: 57,262,448 C491S probably damaging Het
Vmn1r26 A T 6: 58,008,733 M157K probably damaging Het
Zbtb1 A T 12: 76,385,827 S196C probably damaging Het
Zfp236 T C 18: 82,644,062 D582G possibly damaging Het
Zfp384 A G 6: 125,024,910 T125A probably benign Het
Zpr1 T G 9: 46,273,641 probably null Het
Other mutations in Tecrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Tecrl APN 5 83294606 missense probably benign
IGL02067:Tecrl APN 5 83284275 missense probably benign 0.05
IGL02111:Tecrl APN 5 83354792 missense probably damaging 1.00
IGL02391:Tecrl APN 5 83354827 missense probably benign 0.00
IGL02860:Tecrl APN 5 83354997 missense probably benign 0.01
IGL03079:Tecrl APN 5 83294600 missense probably damaging 0.96
IGL03109:Tecrl APN 5 83309309 intron probably benign
BB004:Tecrl UTSW 5 83354819 missense probably damaging 1.00
BB014:Tecrl UTSW 5 83354819 missense probably damaging 1.00
R0095:Tecrl UTSW 5 83294570 splice site probably benign
R0347:Tecrl UTSW 5 83294632 missense probably damaging 1.00
R0372:Tecrl UTSW 5 83294659 missense probably damaging 1.00
R0403:Tecrl UTSW 5 83354758 splice site probably benign
R0426:Tecrl UTSW 5 83354763 splice site probably benign
R0597:Tecrl UTSW 5 83354928 nonsense probably null
R1607:Tecrl UTSW 5 83280508 splice site probably null
R1771:Tecrl UTSW 5 83291287 missense probably damaging 1.00
R1800:Tecrl UTSW 5 83279230 missense probably damaging 1.00
R1815:Tecrl UTSW 5 83279234 missense probably benign 0.01
R1869:Tecrl UTSW 5 83354859 missense probably benign 0.00
R1870:Tecrl UTSW 5 83354859 missense probably benign 0.00
R4296:Tecrl UTSW 5 83313327 nonsense probably null
R4471:Tecrl UTSW 5 83313287 missense probably benign
R6281:Tecrl UTSW 5 83294606 missense probably damaging 1.00
R6343:Tecrl UTSW 5 83294600 missense probably damaging 0.96
R6866:Tecrl UTSW 5 83313314 missense probably damaging 1.00
R6971:Tecrl UTSW 5 83354802 missense possibly damaging 0.58
R6981:Tecrl UTSW 5 83354921 missense possibly damaging 0.83
R7246:Tecrl UTSW 5 83279335 missense probably damaging 0.99
R7282:Tecrl UTSW 5 83354907 missense probably benign 0.26
R7444:Tecrl UTSW 5 83355068 unclassified probably benign
R7900:Tecrl UTSW 5 83279341 missense probably benign 0.04
R7927:Tecrl UTSW 5 83354819 missense probably damaging 1.00
R8246:Tecrl UTSW 5 83279309 missense probably damaging 0.99
R8360:Tecrl UTSW 5 83300917 missense not run
X0019:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0024:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0034:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0035:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0036:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0037:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0038:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0039:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0040:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0052:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0053:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0054:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0058:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0060:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0061:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0062:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0063:Tecrl UTSW 5 83338252 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CAGTTTGTGTGCAGGGTAATTTAAC -3'
(R):5'- ACTCAGATAAAAGGCTTCAAGTCTG -3'

Sequencing Primer
(F):5'- GTGTGCAGGGTAATTTAACATTTTC -3'
(R):5'- AAGGCTTCAAGTCTGATAATATTCAG -3'
Posted On2018-11-28