Incidental Mutation 'R6948:Cyp2c54'
ID 540991
Institutional Source Beutler Lab
Gene Symbol Cyp2c54
Ensembl Gene ENSMUSG00000067225
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 54
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R6948 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 40026384-40062271 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 40034636 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 345 (M345L)
Ref Sequence ENSEMBL: ENSMUSP00000048284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048959]
AlphaFold Q6XVG2
Predicted Effect possibly damaging
Transcript: ENSMUST00000048959
AA Change: M345L

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048284
Gene: ENSMUSG00000067225
AA Change: M345L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 2.2e-159 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap2 A G 2: 91,097,524 (GRCm39) T107A probably benign Het
Calhm3 T A 19: 47,140,344 (GRCm39) M250L probably damaging Het
Catsperb A T 12: 101,447,327 (GRCm39) I276L probably benign Het
Cd70 T C 17: 57,456,594 (GRCm39) E3G probably damaging Het
Cenpj A T 14: 56,790,683 (GRCm39) S455R probably damaging Het
Cgn C G 3: 94,680,531 (GRCm39) E590D probably benign Het
Cpvl T A 6: 53,873,468 (GRCm39) I423F possibly damaging Het
Dner T C 1: 84,383,738 (GRCm39) N549D probably damaging Het
Fat4 T A 3: 39,063,595 (GRCm39) L4517Q probably damaging Het
Fbxw11 A G 11: 32,692,597 (GRCm39) T523A probably damaging Het
Flg A G 3: 93,195,475 (GRCm39) probably benign Het
Gcfc2 A G 6: 81,910,734 (GRCm39) E237G probably benign Het
Ipo5 G T 14: 121,160,527 (GRCm39) M181I probably benign Het
Itprid1 C T 6: 55,955,470 (GRCm39) T1026I probably benign Het
Klhl32 A G 4: 24,629,250 (GRCm39) Y506H probably benign Het
Mast3 G A 8: 71,238,126 (GRCm39) T505I probably damaging Het
Mrgprx2 A T 7: 48,132,464 (GRCm39) V118D possibly damaging Het
Mtor T G 4: 148,621,209 (GRCm39) V1869G probably benign Het
Mycbp2 A T 14: 103,522,703 (GRCm39) M720K possibly damaging Het
Npy4r A G 14: 33,868,731 (GRCm39) Y186H probably benign Het
Obscn A G 11: 58,997,142 (GRCm39) S1520P probably damaging Het
Or10g1b A T 14: 52,627,614 (GRCm39) F205L probably benign Het
Pex1 A G 5: 3,655,994 (GRCm39) N274D probably benign Het
Plxnb1 T C 9: 108,945,702 (GRCm39) Y2078H probably damaging Het
Rasgrp1 T C 2: 117,129,085 (GRCm39) D178G probably damaging Het
Reln A G 5: 22,177,033 (GRCm39) S1878P probably damaging Het
Rims2 T C 15: 39,374,737 (GRCm39) V1033A probably benign Het
Scaf1 G T 7: 44,662,971 (GRCm39) S14* probably null Het
Serpinb9d A G 13: 33,384,706 (GRCm39) S228G possibly damaging Het
Slc22a14 C A 9: 119,060,482 (GRCm39) A93S probably damaging Het
Sox30 G A 11: 45,908,166 (GRCm39) V778M probably damaging Het
Tecrl T C 5: 83,457,097 (GRCm39) I128V probably benign Het
Trip10 T A 17: 57,569,448 (GRCm39) C491S probably damaging Het
Vmn1r26 A T 6: 57,985,718 (GRCm39) M157K probably damaging Het
Zbtb1 A T 12: 76,432,601 (GRCm39) S196C probably damaging Het
Zfp236 T C 18: 82,662,187 (GRCm39) D582G possibly damaging Het
Zfp384 A G 6: 125,001,873 (GRCm39) T125A probably benign Het
Zpr1 T G 9: 46,184,939 (GRCm39) probably null Het
Other mutations in Cyp2c54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Cyp2c54 APN 19 40,060,522 (GRCm39) missense probably damaging 1.00
IGL02694:Cyp2c54 APN 19 40,035,987 (GRCm39) missense possibly damaging 0.55
IGL03170:Cyp2c54 APN 19 40,060,809 (GRCm39) critical splice donor site probably null
IGL03175:Cyp2c54 APN 19 40,058,672 (GRCm39) missense probably benign 0.00
R0097:Cyp2c54 UTSW 19 40,036,103 (GRCm39) splice site probably benign
R0097:Cyp2c54 UTSW 19 40,036,102 (GRCm39) splice site probably benign
R0391:Cyp2c54 UTSW 19 40,060,613 (GRCm39) missense possibly damaging 0.61
R0581:Cyp2c54 UTSW 19 40,035,999 (GRCm39) missense probably benign 0.23
R0787:Cyp2c54 UTSW 19 40,036,079 (GRCm39) missense probably benign 0.12
R1253:Cyp2c54 UTSW 19 40,034,629 (GRCm39) missense probably damaging 1.00
R1481:Cyp2c54 UTSW 19 40,036,032 (GRCm39) missense probably benign 0.30
R1604:Cyp2c54 UTSW 19 40,058,787 (GRCm39) missense probably benign 0.01
R3624:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R3871:Cyp2c54 UTSW 19 40,060,867 (GRCm39) missense probably benign 0.37
R3983:Cyp2c54 UTSW 19 40,034,699 (GRCm39) missense possibly damaging 0.49
R4401:Cyp2c54 UTSW 19 40,060,615 (GRCm39) missense probably benign 0.04
R4416:Cyp2c54 UTSW 19 40,026,703 (GRCm39) missense probably benign 0.04
R4962:Cyp2c54 UTSW 19 40,060,585 (GRCm39) missense possibly damaging 0.90
R5203:Cyp2c54 UTSW 19 40,060,918 (GRCm39) missense probably damaging 1.00
R5634:Cyp2c54 UTSW 19 40,060,858 (GRCm39) missense possibly damaging 0.84
R6083:Cyp2c54 UTSW 19 40,062,206 (GRCm39) missense probably benign 0.20
R6182:Cyp2c54 UTSW 19 40,036,005 (GRCm39) missense probably benign
R6754:Cyp2c54 UTSW 19 40,060,004 (GRCm39) missense probably damaging 1.00
R6901:Cyp2c54 UTSW 19 40,058,703 (GRCm39) missense probably damaging 1.00
R7215:Cyp2c54 UTSW 19 40,034,626 (GRCm39) missense probably damaging 1.00
R7244:Cyp2c54 UTSW 19 40,035,953 (GRCm39) missense probably damaging 1.00
R7278:Cyp2c54 UTSW 19 40,058,697 (GRCm39) nonsense probably null
R7535:Cyp2c54 UTSW 19 40,058,716 (GRCm39) missense probably benign
R7838:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R8039:Cyp2c54 UTSW 19 40,062,176 (GRCm39) frame shift probably null
R8275:Cyp2c54 UTSW 19 40,026,749 (GRCm39) missense probably benign 0.00
R8340:Cyp2c54 UTSW 19 40,060,831 (GRCm39) missense possibly damaging 0.94
R8367:Cyp2c54 UTSW 19 40,062,125 (GRCm39) missense probably damaging 0.99
R8477:Cyp2c54 UTSW 19 40,058,708 (GRCm39) missense probably benign 0.43
R8487:Cyp2c54 UTSW 19 40,059,990 (GRCm39) missense probably damaging 1.00
R8519:Cyp2c54 UTSW 19 40,026,857 (GRCm39) missense probably damaging 0.99
R8534:Cyp2c54 UTSW 19 40,036,030 (GRCm39) missense probably damaging 0.99
R8858:Cyp2c54 UTSW 19 40,062,227 (GRCm39) missense probably benign 0.00
R9215:Cyp2c54 UTSW 19 40,035,950 (GRCm39) missense possibly damaging 0.52
R9236:Cyp2c54 UTSW 19 40,060,938 (GRCm39) nonsense probably null
R9470:Cyp2c54 UTSW 19 40,060,888 (GRCm39) missense probably damaging 1.00
R9792:Cyp2c54 UTSW 19 40,034,525 (GRCm39) missense probably damaging 1.00
Z1176:Cyp2c54 UTSW 19 40,034,659 (GRCm39) missense probably damaging 1.00
Z1177:Cyp2c54 UTSW 19 40,062,201 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CTATCCCATCCATGAATCAGCATAAGG -3'
(R):5'- CACTTTAAGGCACCTTCATTATGC -3'

Sequencing Primer
(F):5'- GGCACTCATAGCACTATATGACTCTG -3'
(R):5'- CACCTTTCACTGTGACCA -3'
Posted On 2018-11-28