Incidental Mutation 'R6899:Tfpi'
ID541001
Institutional Source Beutler Lab
Gene Symbol Tfpi
Ensembl Gene ENSMUSG00000027082
Gene Nametissue factor pathway inhibitor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6899 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location84432855-84476775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84444809 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 152 (G152S)
Ref Sequence ENSEMBL: ENSMUSP00000107351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028487] [ENSMUST00000090732] [ENSMUST00000111711] [ENSMUST00000111714] [ENSMUST00000111717] [ENSMUST00000111718] [ENSMUST00000111722] [ENSMUST00000150261]
Predicted Effect probably damaging
Transcript: ENSMUST00000028487
AA Change: G152S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028487
Gene: ENSMUSG00000027082
AA Change: G152S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 223 276 2.25e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090732
AA Change: G152S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088235
Gene: ENSMUSG00000027082
AA Change: G152S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111711
AA Change: G152S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107340
Gene: ENSMUSG00000027082
AA Change: G152S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111714
AA Change: G152S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107343
Gene: ENSMUSG00000027082
AA Change: G152S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111717
AA Change: G152S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107346
Gene: ENSMUSG00000027082
AA Change: G152S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111718
AA Change: G152S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107347
Gene: ENSMUSG00000027082
AA Change: G152S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 223 276 2.25e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111722
AA Change: G152S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107351
Gene: ENSMUSG00000027082
AA Change: G152S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 217 270 2.25e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150261
AA Change: G145S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122776
Gene: ENSMUSG00000027082
AA Change: G145S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KU 41 94 4.4e-25 SMART
KU 112 165 7.97e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Kunitz-type serine protease inhibitor that regulates the tissue factor (TF)-dependent pathway of blood coagulation. The coagulation process initiates with the formation of a factor VIIa-TF complex, which proteolytically activates additional proteases (factors IX and X) and ultimately leads to the formation of a fibrin clot. The product of this gene inhibits the activated factor X and VIIa-TF proteases in an autoregulatory loop. Inhibition of the encoded protein restores hemostasis in animal models of hemophilia. This gene encodes multiple protein isoforms that differ in their inhibitory activity, specificity and cellular localization. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutant embryos die showing hemorrhages of the yolk sac, central nervous system, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,784 E121G possibly damaging Het
Abca16 A G 7: 120,527,041 Y1140C probably damaging Het
Actl9 G A 17: 33,433,559 G198S probably damaging Het
Adcy2 A T 13: 68,982,381 M129K probably damaging Het
Apmap T A 2: 150,594,308 I107F probably benign Het
Arrdc3 T C 13: 80,889,211 I162T probably damaging Het
Asprv1 T C 6: 86,628,760 L196P probably damaging Het
Bag2 A G 1: 33,746,831 S137P possibly damaging Het
Borcs5 T A 6: 134,710,210 M177K probably benign Het
C8b A T 4: 104,786,874 K246M probably benign Het
Cdo1 A G 18: 46,723,340 C76R probably damaging Het
Ces2b T A 8: 104,836,766 probably null Het
Csf2rb G A 15: 78,340,702 S194N probably benign Het
Dap3 A G 3: 88,933,600 F77L probably benign Het
Dars A G 1: 128,413,746 V44A possibly damaging Het
Dhtkd1 T A 2: 5,917,965 D461V possibly damaging Het
Ero1l A C 14: 45,292,939 H345Q probably benign Het
Fam173b A G 15: 31,617,111 S163G probably benign Het
Fzd8 T A 18: 9,214,729 S604T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gramd1c T A 16: 44,040,142 Y64F probably benign Het
Heatr5b T A 17: 78,803,509 Y970F probably benign Het
Hoxc10 A G 15: 102,967,507 E217G possibly damaging Het
Hsd17b14 A T 7: 45,562,928 H128L possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifna9 A G 4: 88,592,063 F108S probably damaging Het
Ikbke A G 1: 131,275,762 V58A probably damaging Het
Inpp5e G A 2: 26,400,048 R462C possibly damaging Het
Junb A G 8: 84,977,724 F236L probably benign Het
Klhl36 T C 8: 119,870,142 V194A probably benign Het
Lsg1 A T 16: 30,582,088 D134E probably benign Het
Megf8 G T 7: 25,360,713 C2343F probably damaging Het
Myom3 G A 4: 135,803,292 G1172R probably damaging Het
Nasp A T 4: 116,604,333 V548E probably damaging Het
Nubpl T A 12: 52,310,753 S317T probably benign Het
Nup210l A G 3: 90,167,897 D838G possibly damaging Het
Oxsr1 C T 9: 119,247,122 A373T probably benign Het
Psat1 C T 19: 15,918,205 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Slain1 C T 14: 103,650,779 P45L possibly damaging Het
Slc16a8 A G 15: 79,253,749 V20A possibly damaging Het
Slc22a13 A T 9: 119,196,407 M145K probably damaging Het
Slc22a4 G A 11: 53,988,913 T440I probably damaging Het
Slc39a12 C T 2: 14,389,541 P74L probably damaging Het
Sod3 A G 5: 52,368,708 T250A unknown Het
Syne2 A G 12: 76,095,729 probably null Het
Tctn1 A G 5: 122,248,956 Y299H probably damaging Het
Tfcp2l1 A G 1: 118,675,575 M448V probably benign Het
Thap4 A G 1: 93,750,969 S32P probably damaging Het
Tmem132c T A 5: 127,551,680 W549R probably damaging Het
Vmn2r29 T C 7: 7,241,642 E411G probably damaging Het
Washc4 C A 10: 83,576,055 D683E probably benign Het
Wdr3 A T 3: 100,149,901 V462D possibly damaging Het
Wdr5b T C 16: 36,041,780 S90P probably damaging Het
Zfp407 A G 18: 84,561,434 L518P possibly damaging Het
Zfp53 A G 17: 21,508,445 I247V possibly damaging Het
Other mutations in Tfpi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Tfpi APN 2 84444825 nonsense probably null
IGL01860:Tfpi APN 2 84444034 missense probably benign 0.00
IGL02434:Tfpi APN 2 84452548 splice site probably benign
IGL03087:Tfpi APN 2 84444045 missense possibly damaging 0.61
I1329:Tfpi UTSW 2 84444116 missense possibly damaging 0.77
R0883:Tfpi UTSW 2 84443320 splice site probably benign
R1069:Tfpi UTSW 2 84453792 splice site probably benign
R1577:Tfpi UTSW 2 84433103 missense probably damaging 0.97
R1854:Tfpi UTSW 2 84458107 missense probably benign 0.00
R1991:Tfpi UTSW 2 84458016 splice site probably benign
R2910:Tfpi UTSW 2 84444093 missense possibly damaging 0.93
R3085:Tfpi UTSW 2 84442883 utr 3 prime probably benign
R4403:Tfpi UTSW 2 84444862 missense probably damaging 0.98
R4473:Tfpi UTSW 2 84458082 missense probably null 1.00
R4878:Tfpi UTSW 2 84452555 critical splice donor site probably null
R5810:Tfpi UTSW 2 84434424 intron probably benign
R5949:Tfpi UTSW 2 84444748 missense probably benign 0.37
R8024:Tfpi UTSW 2 84453922 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAACCTAACTTCTGTTTGCCCAAC -3'
(R):5'- TCCCGACACTTTAGTAGACTGTTTC -3'

Sequencing Primer
(F):5'- TTGCCCAACTTAAACAGAATCTGAG -3'
(R):5'- ACTTTCATCACCAAAATGGCTAG -3'
Posted On2018-11-28