Incidental Mutation 'R6899:Dap3'
ID541004
Institutional Source Beutler Lab
Gene Symbol Dap3
Ensembl Gene ENSMUSG00000068921
Gene Namedeath associated protein 3
SynonymsDAP-3, 4921514D13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6899 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location88920803-88951181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88933600 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 77 (F77L)
Ref Sequence ENSEMBL: ENSMUSP00000088456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090938] [ENSMUST00000107491] [ENSMUST00000172942] [ENSMUST00000173021] [ENSMUST00000173135] [ENSMUST00000174077] [ENSMUST00000174402] [ENSMUST00000174491]
Predicted Effect probably benign
Transcript: ENSMUST00000090938
AA Change: F77L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000088456
Gene: ENSMUSG00000068921
AA Change: F77L

DomainStartEndE-ValueType
Pfam:DAP3 97 392 2.1e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107491
AA Change: F77L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103115
Gene: ENSMUSG00000068921
AA Change: F77L

DomainStartEndE-ValueType
Pfam:DAP3 97 306 1e-67 PFAM
Pfam:DAP3 300 362 6.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172942
SMART Domains Protein: ENSMUSP00000134145
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 63 133 4.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173021
AA Change: F72L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133314
Gene: ENSMUSG00000068921
AA Change: F72L

DomainStartEndE-ValueType
Pfam:DAP3 92 200 2.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173094
SMART Domains Protein: ENSMUSP00000133486
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 9 140 6.5e-48 PFAM
Pfam:DAP3 134 251 4.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173135
AA Change: F72L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000134422
Gene: ENSMUSG00000068921
AA Change: F72L

DomainStartEndE-ValueType
Pfam:DAP3 92 387 8e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174077
AA Change: F72L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000134433
Gene: ENSMUSG00000068921
AA Change: F72L

DomainStartEndE-ValueType
Pfam:DAP3 92 212 7.1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174402
AA Change: F59L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133395
Gene: ENSMUSG00000068921
AA Change: F59L

DomainStartEndE-ValueType
Pfam:DAP3 79 165 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174491
Predicted Effect probably benign
Transcript: ENSMUST00000174571
SMART Domains Protein: ENSMUSP00000133349
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 1 102 4.7e-36 PFAM
Pfam:DAP3 99 213 7e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that also participates in apoptotic pathways which are initiated by tumor necrosis factor-alpha, Fas ligand, and gamma interferon. This protein potentially binds ATP/GTP and might be a functional partner of the mitoribosomal protein S27. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Pseudogenes corresponding to this gene are found on chromosomes 1q and 2q. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality with defects in mitochondria morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,784 E121G possibly damaging Het
Abca16 A G 7: 120,527,041 Y1140C probably damaging Het
Actl9 G A 17: 33,433,559 G198S probably damaging Het
Adcy2 A T 13: 68,982,381 M129K probably damaging Het
Apmap T A 2: 150,594,308 I107F probably benign Het
Arrdc3 T C 13: 80,889,211 I162T probably damaging Het
Asprv1 T C 6: 86,628,760 L196P probably damaging Het
Bag2 A G 1: 33,746,831 S137P possibly damaging Het
Borcs5 T A 6: 134,710,210 M177K probably benign Het
C8b A T 4: 104,786,874 K246M probably benign Het
Cdo1 A G 18: 46,723,340 C76R probably damaging Het
Ces2b T A 8: 104,836,766 probably null Het
Csf2rb G A 15: 78,340,702 S194N probably benign Het
Dars A G 1: 128,413,746 V44A possibly damaging Het
Dhtkd1 T A 2: 5,917,965 D461V possibly damaging Het
Ero1l A C 14: 45,292,939 H345Q probably benign Het
Fam173b A G 15: 31,617,111 S163G probably benign Het
Fzd8 T A 18: 9,214,729 S604T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gramd1c T A 16: 44,040,142 Y64F probably benign Het
Heatr5b T A 17: 78,803,509 Y970F probably benign Het
Hoxc10 A G 15: 102,967,507 E217G possibly damaging Het
Hsd17b14 A T 7: 45,562,928 H128L possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifna9 A G 4: 88,592,063 F108S probably damaging Het
Ikbke A G 1: 131,275,762 V58A probably damaging Het
Inpp5e G A 2: 26,400,048 R462C possibly damaging Het
Junb A G 8: 84,977,724 F236L probably benign Het
Klhl36 T C 8: 119,870,142 V194A probably benign Het
Lsg1 A T 16: 30,582,088 D134E probably benign Het
Megf8 G T 7: 25,360,713 C2343F probably damaging Het
Myom3 G A 4: 135,803,292 G1172R probably damaging Het
Nasp A T 4: 116,604,333 V548E probably damaging Het
Nubpl T A 12: 52,310,753 S317T probably benign Het
Nup210l A G 3: 90,167,897 D838G possibly damaging Het
Oxsr1 C T 9: 119,247,122 A373T probably benign Het
Psat1 C T 19: 15,918,205 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Slain1 C T 14: 103,650,779 P45L possibly damaging Het
Slc16a8 A G 15: 79,253,749 V20A possibly damaging Het
Slc22a13 A T 9: 119,196,407 M145K probably damaging Het
Slc22a4 G A 11: 53,988,913 T440I probably damaging Het
Slc39a12 C T 2: 14,389,541 P74L probably damaging Het
Sod3 A G 5: 52,368,708 T250A unknown Het
Syne2 A G 12: 76,095,729 probably null Het
Tctn1 A G 5: 122,248,956 Y299H probably damaging Het
Tfcp2l1 A G 1: 118,675,575 M448V probably benign Het
Tfpi C T 2: 84,444,809 G152S probably damaging Het
Thap4 A G 1: 93,750,969 S32P probably damaging Het
Tmem132c T A 5: 127,551,680 W549R probably damaging Het
Vmn2r29 T C 7: 7,241,642 E411G probably damaging Het
Washc4 C A 10: 83,576,055 D683E probably benign Het
Wdr3 A T 3: 100,149,901 V462D possibly damaging Het
Wdr5b T C 16: 36,041,780 S90P probably damaging Het
Zfp407 A G 18: 84,561,434 L518P possibly damaging Het
Zfp53 A G 17: 21,508,445 I247V possibly damaging Het
Other mutations in Dap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Dap3 APN 3 88936228 missense probably benign 0.23
IGL02111:Dap3 APN 3 88929418 missense probably benign 0.26
IGL02453:Dap3 APN 3 88928327 missense probably benign 0.07
IGL02989:Dap3 APN 3 88930571 splice site probably benign
R0094:Dap3 UTSW 3 88927028 missense probably benign 0.01
R0665:Dap3 UTSW 3 88930997 nonsense probably null
R1853:Dap3 UTSW 3 88930926 missense probably damaging 1.00
R1885:Dap3 UTSW 3 88930974 missense probably damaging 1.00
R1887:Dap3 UTSW 3 88930974 missense probably damaging 1.00
R2351:Dap3 UTSW 3 88933563 critical splice donor site probably null
R2513:Dap3 UTSW 3 88928258 missense probably benign 0.15
R4449:Dap3 UTSW 3 88949878 unclassified probably benign
R4749:Dap3 UTSW 3 88926310 missense probably benign 0.00
R5359:Dap3 UTSW 3 88930989 missense probably damaging 1.00
R5502:Dap3 UTSW 3 88925326 missense probably damaging 1.00
R6919:Dap3 UTSW 3 88930989 missense probably damaging 0.98
R6946:Dap3 UTSW 3 88938216 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TAAACGTGGTGCCTACGAGTC -3'
(R):5'- TAACTGTTTGCCCAAGCTGTG -3'

Sequencing Primer
(F):5'- CGTGGTGCCTACGAGTCCTTAG -3'
(R):5'- TGCAAGGACTTTATAGCCTAGGC -3'
Posted On2018-11-28