Incidental Mutation 'R6899:Abca16'
ID541019
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene NameATP-binding cassette, sub-family A (ABC1), member 16
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6899 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location120409647-120544813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120527041 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1140 (Y1140C)
Ref Sequence ENSEMBL: ENSMUSP00000061094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
Predicted Effect probably damaging
Transcript: ENSMUST00000056042
AA Change: Y1140C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: Y1140C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120490
AA Change: Y1141C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: Y1141C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.9%
Validation Efficiency 98% (56/57)
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,784 E121G possibly damaging Het
Actl9 G A 17: 33,433,559 G198S probably damaging Het
Adcy2 A T 13: 68,982,381 M129K probably damaging Het
Apmap T A 2: 150,594,308 I107F probably benign Het
Arrdc3 T C 13: 80,889,211 I162T probably damaging Het
Asprv1 T C 6: 86,628,760 L196P probably damaging Het
Bag2 A G 1: 33,746,831 S137P possibly damaging Het
Borcs5 T A 6: 134,710,210 M177K probably benign Het
C8b A T 4: 104,786,874 K246M probably benign Het
Cdo1 A G 18: 46,723,340 C76R probably damaging Het
Ces2b T A 8: 104,836,766 probably null Het
Csf2rb G A 15: 78,340,702 S194N probably benign Het
Dap3 A G 3: 88,933,600 F77L probably benign Het
Dars A G 1: 128,413,746 V44A possibly damaging Het
Dhtkd1 T A 2: 5,917,965 D461V possibly damaging Het
Ero1l A C 14: 45,292,939 H345Q probably benign Het
Fam173b A G 15: 31,617,111 S163G probably benign Het
Fzd8 T A 18: 9,214,729 S604T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gramd1c T A 16: 44,040,142 Y64F probably benign Het
Heatr5b T A 17: 78,803,509 Y970F probably benign Het
Hoxc10 A G 15: 102,967,507 E217G possibly damaging Het
Hsd17b14 A T 7: 45,562,928 H128L possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifna9 A G 4: 88,592,063 F108S probably damaging Het
Ikbke A G 1: 131,275,762 V58A probably damaging Het
Inpp5e G A 2: 26,400,048 R462C possibly damaging Het
Junb A G 8: 84,977,724 F236L probably benign Het
Klhl36 T C 8: 119,870,142 V194A probably benign Het
Lsg1 A T 16: 30,582,088 D134E probably benign Het
Megf8 G T 7: 25,360,713 C2343F probably damaging Het
Myom3 G A 4: 135,803,292 G1172R probably damaging Het
Nasp A T 4: 116,604,333 V548E probably damaging Het
Nubpl T A 12: 52,310,753 S317T probably benign Het
Nup210l A G 3: 90,167,897 D838G possibly damaging Het
Oxsr1 C T 9: 119,247,122 A373T probably benign Het
Psat1 C T 19: 15,918,205 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Slain1 C T 14: 103,650,779 P45L possibly damaging Het
Slc16a8 A G 15: 79,253,749 V20A possibly damaging Het
Slc22a13 A T 9: 119,196,407 M145K probably damaging Het
Slc22a4 G A 11: 53,988,913 T440I probably damaging Het
Slc39a12 C T 2: 14,389,541 P74L probably damaging Het
Sod3 A G 5: 52,368,708 T250A unknown Het
Syne2 A G 12: 76,095,729 probably null Het
Tctn1 A G 5: 122,248,956 Y299H probably damaging Het
Tfcp2l1 A G 1: 118,675,575 M448V probably benign Het
Tfpi C T 2: 84,444,809 G152S probably damaging Het
Thap4 A G 1: 93,750,969 S32P probably damaging Het
Tmem132c T A 5: 127,551,680 W549R probably damaging Het
Vmn2r29 T C 7: 7,241,642 E411G probably damaging Het
Washc4 C A 10: 83,576,055 D683E probably benign Het
Wdr3 A T 3: 100,149,901 V462D possibly damaging Het
Wdr5b T C 16: 36,041,780 S90P probably damaging Het
Zfp407 A G 18: 84,561,434 L518P possibly damaging Het
Zfp53 A G 17: 21,508,445 I247V possibly damaging Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120423759 missense probably benign 0.08
IGL00590:Abca16 APN 7 120423815 missense probably damaging 1.00
IGL01320:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01322:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01613:Abca16 APN 7 120541277 missense probably benign 0.03
IGL01774:Abca16 APN 7 120477835 missense probably damaging 1.00
IGL01774:Abca16 APN 7 120421801 splice site probably benign
IGL01797:Abca16 APN 7 120514537 missense probably benign 0.15
IGL02406:Abca16 APN 7 120540602 missense probably damaging 1.00
IGL02437:Abca16 APN 7 120533729 missense probably benign 0.00
IGL02541:Abca16 APN 7 120514658 missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120433455 missense probably benign 0.05
IGL02578:Abca16 APN 7 120423956 critical splice donor site probably null
IGL03156:Abca16 APN 7 120423851 missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120527818 missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120540128 missense probably benign 0.31
R0024:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0123:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0134:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0225:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0346:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R0355:Abca16 UTSW 7 120423798 missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120544716 missense probably benign 0.01
R0525:Abca16 UTSW 7 120465810 nonsense probably null
R0617:Abca16 UTSW 7 120433611 splice site probably benign
R0625:Abca16 UTSW 7 120435893 missense probably damaging 1.00
R0835:Abca16 UTSW 7 120465784 missense probably benign 0.42
R1445:Abca16 UTSW 7 120520033 missense probably benign 0.41
R1535:Abca16 UTSW 7 120540705 missense probably benign 0.30
R1567:Abca16 UTSW 7 120431129 missense probably benign 0.08
R1694:Abca16 UTSW 7 120520084 missense probably damaging 1.00
R1860:Abca16 UTSW 7 120534763 missense probably benign 0.02
R1876:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R1913:Abca16 UTSW 7 120541240 missense probably benign 0.04
R1940:Abca16 UTSW 7 120433609 splice site probably benign
R2042:Abca16 UTSW 7 120544718 missense probably benign
R2115:Abca16 UTSW 7 120540645 missense probably damaging 1.00
R2122:Abca16 UTSW 7 120519961 missense probably damaging 1.00
R2265:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2267:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2269:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2993:Abca16 UTSW 7 120535161 missense probably damaging 1.00
R3055:Abca16 UTSW 7 120435851 missense probably benign 0.05
R3956:Abca16 UTSW 7 120527752 missense probably damaging 0.96
R4114:Abca16 UTSW 7 120527067 missense probably benign 0.06
R4441:Abca16 UTSW 7 120527801 missense probably benign 0.04
R4601:Abca16 UTSW 7 120436697 missense probably damaging 0.98
R4706:Abca16 UTSW 7 120465765 missense probably damaging 1.00
R4807:Abca16 UTSW 7 120540609 missense probably damaging 1.00
R4824:Abca16 UTSW 7 120475479 missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120527086 missense probably damaging 0.98
R5152:Abca16 UTSW 7 120540623 missense probably benign 0.02
R5257:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5258:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5330:Abca16 UTSW 7 120503377 missense probably benign 0.15
R5388:Abca16 UTSW 7 120540746 critical splice donor site probably null
R5590:Abca16 UTSW 7 120544772 missense probably damaging 0.98
R5810:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6161:Abca16 UTSW 7 120540711 missense probably damaging 1.00
R6313:Abca16 UTSW 7 120527121 missense probably damaging 1.00
R6485:Abca16 UTSW 7 120427167 nonsense probably null
R6527:Abca16 UTSW 7 120477772 missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120527053 missense probably damaging 1.00
R6885:Abca16 UTSW 7 120520109 missense probably benign 0.07
R6941:Abca16 UTSW 7 120541147 missense probably damaging 1.00
R6990:Abca16 UTSW 7 120527727 missense probably benign 0.00
R7059:Abca16 UTSW 7 120421748 missense probably benign 0.00
R7144:Abca16 UTSW 7 120433573 missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120527751 missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120427186 missense probably damaging 1.00
R7308:Abca16 UTSW 7 120423770 missense probably benign 0.01
R7449:Abca16 UTSW 7 120435908 missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120519988 missense probably benign 0.11
R7617:Abca16 UTSW 7 120503471 nonsense probably null
R7646:Abca16 UTSW 7 120514714 missense probably benign 0.04
X0066:Abca16 UTSW 7 120503386 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGTGCTCGTTGTAATAATCTCAG -3'
(R):5'- ACTGGTTGCCACTTGTACCC -3'

Sequencing Primer
(F):5'- GGTTCACTTTAAGGCTTGAACTC -3'
(R):5'- GCAGCAGTGCTACTATTG -3'
Posted On2018-11-28