Incidental Mutation 'R6899:Oxsr1'
ID541023
Institutional Source Beutler Lab
Gene Symbol Oxsr1
Ensembl Gene ENSMUSG00000036737
Gene Nameoxidative-stress responsive 1
Synonyms2210022N24Rik, Osr1, 2810422B09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6899 (G1)
Quality Score206.009
Status Validated
Chromosome9
Chromosomal Location119238432-119322427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119247122 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 373 (A373T)
Ref Sequence ENSEMBL: ENSMUSP00000042155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040853] [ENSMUST00000128880] [ENSMUST00000143728] [ENSMUST00000170400]
Predicted Effect probably benign
Transcript: ENSMUST00000040853
AA Change: A373T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000042155
Gene: ENSMUSG00000036737
AA Change: A373T

DomainStartEndE-ValueType
S_TKc 17 291 1.45e-84 SMART
low complexity region 332 350 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
Pfam:OSR1_C 434 465 3.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128880
SMART Domains Protein: ENSMUSP00000122692
Gene: ENSMUSG00000036737

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 100 6.3e-13 PFAM
Pfam:Pkinase 17 111 1.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143728
SMART Domains Protein: ENSMUSP00000117327
Gene: ENSMUSG00000036737

DomainStartEndE-ValueType
PDB:2VWI|D 1 32 2e-14 PDB
SCOP:d1f3mc_ 1 33 1e-7 SMART
low complexity region 61 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the Ser/Thr protein kinase family of proteins. It regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,784 E121G possibly damaging Het
Abca16 A G 7: 120,527,041 Y1140C probably damaging Het
Actl9 G A 17: 33,433,559 G198S probably damaging Het
Adcy2 A T 13: 68,982,381 M129K probably damaging Het
Apmap T A 2: 150,594,308 I107F probably benign Het
Arrdc3 T C 13: 80,889,211 I162T probably damaging Het
Asprv1 T C 6: 86,628,760 L196P probably damaging Het
Bag2 A G 1: 33,746,831 S137P possibly damaging Het
Borcs5 T A 6: 134,710,210 M177K probably benign Het
C8b A T 4: 104,786,874 K246M probably benign Het
Cdo1 A G 18: 46,723,340 C76R probably damaging Het
Ces2b T A 8: 104,836,766 probably null Het
Csf2rb G A 15: 78,340,702 S194N probably benign Het
Dap3 A G 3: 88,933,600 F77L probably benign Het
Dars A G 1: 128,413,746 V44A possibly damaging Het
Dhtkd1 T A 2: 5,917,965 D461V possibly damaging Het
Ero1l A C 14: 45,292,939 H345Q probably benign Het
Fam173b A G 15: 31,617,111 S163G probably benign Het
Fzd8 T A 18: 9,214,729 S604T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gramd1c T A 16: 44,040,142 Y64F probably benign Het
Heatr5b T A 17: 78,803,509 Y970F probably benign Het
Hoxc10 A G 15: 102,967,507 E217G possibly damaging Het
Hsd17b14 A T 7: 45,562,928 H128L possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifna9 A G 4: 88,592,063 F108S probably damaging Het
Ikbke A G 1: 131,275,762 V58A probably damaging Het
Inpp5e G A 2: 26,400,048 R462C possibly damaging Het
Junb A G 8: 84,977,724 F236L probably benign Het
Klhl36 T C 8: 119,870,142 V194A probably benign Het
Lsg1 A T 16: 30,582,088 D134E probably benign Het
Megf8 G T 7: 25,360,713 C2343F probably damaging Het
Myom3 G A 4: 135,803,292 G1172R probably damaging Het
Nasp A T 4: 116,604,333 V548E probably damaging Het
Nubpl T A 12: 52,310,753 S317T probably benign Het
Nup210l A G 3: 90,167,897 D838G possibly damaging Het
Psat1 C T 19: 15,918,205 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Slain1 C T 14: 103,650,779 P45L possibly damaging Het
Slc16a8 A G 15: 79,253,749 V20A possibly damaging Het
Slc22a13 A T 9: 119,196,407 M145K probably damaging Het
Slc22a4 G A 11: 53,988,913 T440I probably damaging Het
Slc39a12 C T 2: 14,389,541 P74L probably damaging Het
Sod3 A G 5: 52,368,708 T250A unknown Het
Syne2 A G 12: 76,095,729 probably null Het
Tctn1 A G 5: 122,248,956 Y299H probably damaging Het
Tfcp2l1 A G 1: 118,675,575 M448V probably benign Het
Tfpi C T 2: 84,444,809 G152S probably damaging Het
Thap4 A G 1: 93,750,969 S32P probably damaging Het
Tmem132c T A 5: 127,551,680 W549R probably damaging Het
Vmn2r29 T C 7: 7,241,642 E411G probably damaging Het
Washc4 C A 10: 83,576,055 D683E probably benign Het
Wdr3 A T 3: 100,149,901 V462D possibly damaging Het
Wdr5b T C 16: 36,041,780 S90P probably damaging Het
Zfp407 A G 18: 84,561,434 L518P possibly damaging Het
Zfp53 A G 17: 21,508,445 I247V possibly damaging Het
Other mutations in Oxsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Oxsr1 APN 9 119259211 missense probably damaging 1.00
IGL01380:Oxsr1 APN 9 119260101 intron probably benign
IGL02542:Oxsr1 APN 9 119242735 missense possibly damaging 0.67
IGL02806:Oxsr1 APN 9 119241194 missense possibly damaging 0.55
R0629:Oxsr1 UTSW 9 119241784 intron probably benign
R2048:Oxsr1 UTSW 9 119247074 missense probably benign
R2094:Oxsr1 UTSW 9 119294494 missense probably benign 0.22
R2159:Oxsr1 UTSW 9 119304814 missense possibly damaging 0.52
R2165:Oxsr1 UTSW 9 119294432 missense probably damaging 1.00
R3905:Oxsr1 UTSW 9 119247112 missense probably benign
R6017:Oxsr1 UTSW 9 119264777 missense probably benign 0.00
R6286:Oxsr1 UTSW 9 119264882 missense probably damaging 0.99
R7091:Oxsr1 UTSW 9 119284661 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTTCTATCATCTGCCCACAGG -3'
(R):5'- GATTAGTCTCGACTACCTAGCAAG -3'

Sequencing Primer
(F):5'- GCGTCGGGCCAGGAAAAC -3'
(R):5'- GCAAGTTGCAGACCAGCCTC -3'
Posted On2018-11-28