Incidental Mutation 'R6899:Csf2rb'
ID 541034
Institutional Source Beutler Lab
Gene Symbol Csf2rb
Ensembl Gene ENSMUSG00000071713
Gene Name colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Synonyms Csf2rb1, AIC2B, Il5rb, Bc, Il3rb1, beta c, Il3r, common beta chain, CDw131
MMRRC Submission
Accession Numbers

Genbank: NM_007780; MGI: 1339759

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6899 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 78325752-78353847 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 78340702 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 194 (S194N)
Ref Sequence ENSEMBL: ENSMUSP00000155092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096355] [ENSMUST00000229034] [ENSMUST00000229678] [ENSMUST00000230264] [ENSMUST00000231888]
AlphaFold P26955
Predicted Effect probably benign
Transcript: ENSMUST00000096355
AA Change: S194N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000094082
Gene: ENSMUSG00000071713
AA Change: S194N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCOP:d1gh7a1 29 130 6e-58 SMART
FN3 136 224 4.44e0 SMART
Blast:FN3 245 338 3e-24 BLAST
SCOP:d1gh7a3 245 338 2e-45 SMART
FN3 343 426 2.41e0 SMART
transmembrane domain 446 468 N/A INTRINSIC
low complexity region 716 743 N/A INTRINSIC
low complexity region 824 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229034
Predicted Effect probably benign
Transcript: ENSMUST00000229678
AA Change: S194N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000230264
AA Change: S194N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000231888
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.9%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit lung pathology including lymphocytic infiltration, alveolar proteinosis-like areas, and increased saturated phosphatidylcholine pool sizes. Mutants also have low peripheral eosinophil numbers. [provided by MGI curators]
Allele List at MGI

 All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,784 E121G possibly damaging Het
Abca16 A G 7: 120,527,041 Y1140C probably damaging Het
Actl9 G A 17: 33,433,559 G198S probably damaging Het
Adcy2 A T 13: 68,982,381 M129K probably damaging Het
Apmap T A 2: 150,594,308 I107F probably benign Het
Arrdc3 T C 13: 80,889,211 I162T probably damaging Het
Asprv1 T C 6: 86,628,760 L196P probably damaging Het
Bag2 A G 1: 33,746,831 S137P possibly damaging Het
Borcs5 T A 6: 134,710,210 M177K probably benign Het
C8b A T 4: 104,786,874 K246M probably benign Het
Cdo1 A G 18: 46,723,340 C76R probably damaging Het
Ces2b T A 8: 104,836,766 probably null Het
Dap3 A G 3: 88,933,600 F77L probably benign Het
Dars A G 1: 128,413,746 V44A possibly damaging Het
Dhtkd1 T A 2: 5,917,965 D461V possibly damaging Het
Ero1l A C 14: 45,292,939 H345Q probably benign Het
Fam173b A G 15: 31,617,111 S163G probably benign Het
Fzd8 T A 18: 9,214,729 S604T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gramd1c T A 16: 44,040,142 Y64F probably benign Het
Heatr5b T A 17: 78,803,509 Y970F probably benign Het
Hoxc10 A G 15: 102,967,507 E217G possibly damaging Het
Hsd17b14 A T 7: 45,562,928 H128L possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifna9 A G 4: 88,592,063 F108S probably damaging Het
Ikbke A G 1: 131,275,762 V58A probably damaging Het
Inpp5e G A 2: 26,400,048 R462C possibly damaging Het
Junb A G 8: 84,977,724 F236L probably benign Het
Klhl36 T C 8: 119,870,142 V194A probably benign Het
Lsg1 A T 16: 30,582,088 D134E probably benign Het
Megf8 G T 7: 25,360,713 C2343F probably damaging Het
Myom3 G A 4: 135,803,292 G1172R probably damaging Het
Nasp A T 4: 116,604,333 V548E probably damaging Het
Nubpl T A 12: 52,310,753 S317T probably benign Het
Nup210l A G 3: 90,167,897 D838G possibly damaging Het
Oxsr1 C T 9: 119,247,122 A373T probably benign Het
Psat1 C T 19: 15,918,205 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Slain1 C T 14: 103,650,779 P45L possibly damaging Het
Slc16a8 A G 15: 79,253,749 V20A possibly damaging Het
Slc22a13 A T 9: 119,196,407 M145K probably damaging Het
Slc22a4 G A 11: 53,988,913 T440I probably damaging Het
Slc39a12 C T 2: 14,389,541 P74L probably damaging Het
Sod3 A G 5: 52,368,708 T250A unknown Het
Syne2 A G 12: 76,095,729 probably null Het
Tctn1 A G 5: 122,248,956 Y299H probably damaging Het
Tfcp2l1 A G 1: 118,675,575 M448V probably benign Het
Tfpi C T 2: 84,444,809 G152S probably damaging Het
Thap4 A G 1: 93,750,969 S32P probably damaging Het
Tmem132c T A 5: 127,551,680 W549R probably damaging Het
Vmn2r29 T C 7: 7,241,642 E411G probably damaging Het
Washc4 C A 10: 83,576,055 D683E probably benign Het
Wdr3 A T 3: 100,149,901 V462D possibly damaging Het
Wdr5b T C 16: 36,041,780 S90P probably damaging Het
Zfp407 A G 18: 84,561,434 L518P possibly damaging Het
Zfp53 A G 17: 21,508,445 I247V possibly damaging Het
Other mutations in Csf2rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Csf2rb APN 15 78348514 nonsense probably null
IGL00979:Csf2rb APN 15 78348104 missense probably damaging 1.00
IGL01613:Csf2rb APN 15 78335302 intron probably benign
IGL01724:Csf2rb APN 15 78336414 missense probably damaging 1.00
IGL01942:Csf2rb APN 15 78340492 missense probably benign
IGL02479:Csf2rb APN 15 78341724 nonsense probably null
3-1:Csf2rb UTSW 15 78344603 missense probably damaging 1.00
IGL02802:Csf2rb UTSW 15 78338903 missense probably benign 0.00
R0133:Csf2rb UTSW 15 78339004 unclassified probably benign
R0179:Csf2rb UTSW 15 78336372 missense possibly damaging 0.52
R0487:Csf2rb UTSW 15 78348331 missense probably benign 0.00
R1544:Csf2rb UTSW 15 78340755 missense probably benign 0.02
R1619:Csf2rb UTSW 15 78335211 missense probably damaging 0.99
R1690:Csf2rb UTSW 15 78348644 missense probably benign 0.11
R1831:Csf2rb UTSW 15 78348253 missense probably benign 0.03
R3970:Csf2rb UTSW 15 78341467 missense probably benign
R4922:Csf2rb UTSW 15 78346467 missense probably benign 0.02
R5151:Csf2rb UTSW 15 78340581 missense probably damaging 1.00
R5202:Csf2rb UTSW 15 78349057 missense possibly damaging 0.51
R5398:Csf2rb UTSW 15 78348620 missense probably benign
R5496:Csf2rb UTSW 15 78340561 missense probably damaging 1.00
R5786:Csf2rb UTSW 15 78348955 missense probably damaging 1.00
R6166:Csf2rb UTSW 15 78344566 missense probably damaging 1.00
R6347:Csf2rb UTSW 15 78345552 missense probably damaging 0.99
R6350:Csf2rb UTSW 15 78345552 missense probably damaging 0.99
R6984:Csf2rb UTSW 15 78345519 missense probably damaging 1.00
R7484:Csf2rb UTSW 15 78338899 missense possibly damaging 0.53
R7671:Csf2rb UTSW 15 78338930 missense probably damaging 1.00
R7751:Csf2rb UTSW 15 78341639 missense probably damaging 1.00
R7781:Csf2rb UTSW 15 78344571 missense probably benign 0.00
R7861:Csf2rb UTSW 15 78349157 missense probably damaging 1.00
R8135:Csf2rb UTSW 15 78348119 missense possibly damaging 0.95
R8154:Csf2rb UTSW 15 78340442 critical splice acceptor site probably null
R8299:Csf2rb UTSW 15 78346469 missense possibly damaging 0.88
R8315:Csf2rb UTSW 15 78347381 missense possibly damaging 0.83
R8926:Csf2rb UTSW 15 78340549 missense probably benign
R8948:Csf2rb UTSW 15 78348320 missense probably benign 0.05
R8950:Csf2rb UTSW 15 78348320 missense probably benign 0.05
R9265:Csf2rb UTSW 15 78348546 missense probably benign 0.08
X0024:Csf2rb UTSW 15 78336360 missense probably damaging 1.00
X0028:Csf2rb UTSW 15 78349002 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTCCTGGCTTTCATCAAAG -3'
(R):5'- ATGTCGAGGTAGGGCAGATC -3'

Sequencing Primer
(F):5'- CTCCTGGCTTTCATCAAAGGACATAG -3'
(R):5'- CTAGTCTCCTAAAAGGGGCATGTC -3'
Posted On 2018-11-28