Incidental Mutation 'R6899:Lsg1'
ID541037
Institutional Source Beutler Lab
Gene Symbol Lsg1
Ensembl Gene ENSMUSG00000022538
Gene Namelarge 60S subunit nuclear export GTPase 1
SynonymsD16Bwg1547e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R6899 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location30560494-30587592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30582088 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 134 (D134E)
Ref Sequence ENSEMBL: ENSMUSP00000112860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117363]
Predicted Effect probably benign
Transcript: ENSMUST00000117363
AA Change: D134E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112860
Gene: ENSMUSG00000022538
AA Change: D134E

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
coiled coil region 129 151 N/A INTRINSIC
SCOP:d1h65a_ 165 280 2e-3 SMART
low complexity region 300 309 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
Pfam:MMR_HSR1 374 461 1.3e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to the yeast large subunit GTPase 1. The encoded protein is necessary for cell viability and may localize in the endoplasmic reticulum, nucleus and cytoplasm.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,784 E121G possibly damaging Het
Abca16 A G 7: 120,527,041 Y1140C probably damaging Het
Actl9 G A 17: 33,433,559 G198S probably damaging Het
Adcy2 A T 13: 68,982,381 M129K probably damaging Het
Apmap T A 2: 150,594,308 I107F probably benign Het
Arrdc3 T C 13: 80,889,211 I162T probably damaging Het
Asprv1 T C 6: 86,628,760 L196P probably damaging Het
Bag2 A G 1: 33,746,831 S137P possibly damaging Het
Borcs5 T A 6: 134,710,210 M177K probably benign Het
C8b A T 4: 104,786,874 K246M probably benign Het
Cdo1 A G 18: 46,723,340 C76R probably damaging Het
Ces2b T A 8: 104,836,766 probably null Het
Csf2rb G A 15: 78,340,702 S194N probably benign Het
Dap3 A G 3: 88,933,600 F77L probably benign Het
Dars A G 1: 128,413,746 V44A possibly damaging Het
Dhtkd1 T A 2: 5,917,965 D461V possibly damaging Het
Ero1l A C 14: 45,292,939 H345Q probably benign Het
Fam173b A G 15: 31,617,111 S163G probably benign Het
Fzd8 T A 18: 9,214,729 S604T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gramd1c T A 16: 44,040,142 Y64F probably benign Het
Heatr5b T A 17: 78,803,509 Y970F probably benign Het
Hoxc10 A G 15: 102,967,507 E217G possibly damaging Het
Hsd17b14 A T 7: 45,562,928 H128L possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifna9 A G 4: 88,592,063 F108S probably damaging Het
Ikbke A G 1: 131,275,762 V58A probably damaging Het
Inpp5e G A 2: 26,400,048 R462C possibly damaging Het
Junb A G 8: 84,977,724 F236L probably benign Het
Klhl36 T C 8: 119,870,142 V194A probably benign Het
Megf8 G T 7: 25,360,713 C2343F probably damaging Het
Myom3 G A 4: 135,803,292 G1172R probably damaging Het
Nasp A T 4: 116,604,333 V548E probably damaging Het
Nubpl T A 12: 52,310,753 S317T probably benign Het
Nup210l A G 3: 90,167,897 D838G possibly damaging Het
Oxsr1 C T 9: 119,247,122 A373T probably benign Het
Psat1 C T 19: 15,918,205 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Slain1 C T 14: 103,650,779 P45L possibly damaging Het
Slc16a8 A G 15: 79,253,749 V20A possibly damaging Het
Slc22a13 A T 9: 119,196,407 M145K probably damaging Het
Slc22a4 G A 11: 53,988,913 T440I probably damaging Het
Slc39a12 C T 2: 14,389,541 P74L probably damaging Het
Sod3 A G 5: 52,368,708 T250A unknown Het
Syne2 A G 12: 76,095,729 probably null Het
Tctn1 A G 5: 122,248,956 Y299H probably damaging Het
Tfcp2l1 A G 1: 118,675,575 M448V probably benign Het
Tfpi C T 2: 84,444,809 G152S probably damaging Het
Thap4 A G 1: 93,750,969 S32P probably damaging Het
Tmem132c T A 5: 127,551,680 W549R probably damaging Het
Vmn2r29 T C 7: 7,241,642 E411G probably damaging Het
Washc4 C A 10: 83,576,055 D683E probably benign Het
Wdr3 A T 3: 100,149,901 V462D possibly damaging Het
Wdr5b T C 16: 36,041,780 S90P probably damaging Het
Zfp407 A G 18: 84,561,434 L518P possibly damaging Het
Zfp53 A G 17: 21,508,445 I247V possibly damaging Het
Other mutations in Lsg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Lsg1 APN 16 30582095 missense probably damaging 1.00
IGL02023:Lsg1 APN 16 30585676 missense probably damaging 1.00
IGL02530:Lsg1 APN 16 30571242 missense probably benign 0.31
IGL02647:Lsg1 APN 16 30585552 critical splice donor site probably null
IGL02710:Lsg1 APN 16 30571474 missense probably benign
IGL02714:Lsg1 APN 16 30585550 splice site probably null
IGL02938:Lsg1 APN 16 30571206 missense probably benign
R1349:Lsg1 UTSW 16 30564654 missense possibly damaging 0.94
R1372:Lsg1 UTSW 16 30564654 missense possibly damaging 0.94
R1569:Lsg1 UTSW 16 30581005 synonymous probably null
R1667:Lsg1 UTSW 16 30571352 missense probably damaging 1.00
R2445:Lsg1 UTSW 16 30564695 missense probably benign 0.01
R2991:Lsg1 UTSW 16 30561729 missense probably damaging 0.97
R3611:Lsg1 UTSW 16 30561795 missense probably benign 0.04
R4256:Lsg1 UTSW 16 30573243 missense probably benign 0.01
R4700:Lsg1 UTSW 16 30565449 missense probably damaging 0.99
R4750:Lsg1 UTSW 16 30565449 missense probably damaging 0.99
R5114:Lsg1 UTSW 16 30561720 missense probably damaging 1.00
R5580:Lsg1 UTSW 16 30569167 missense probably null 0.91
R5589:Lsg1 UTSW 16 30581001 missense probably damaging 1.00
R5719:Lsg1 UTSW 16 30561775 missense probably benign 0.00
R5721:Lsg1 UTSW 16 30561775 missense probably benign 0.00
R6377:Lsg1 UTSW 16 30574568 missense possibly damaging 0.95
R7469:Lsg1 UTSW 16 30561817 missense probably benign 0.08
R7530:Lsg1 UTSW 16 30582601 missense possibly damaging 0.65
X0065:Lsg1 UTSW 16 30571458 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTACAATCGCATTTTCTTGG -3'
(R):5'- AAGAACACGCAGCTACTGAG -3'

Sequencing Primer
(F):5'- GGACAACTTGGAGGAATCATCTCTC -3'
(R):5'- GAACACGCAGCTACTGAGTATATTC -3'
Posted On2018-11-28