Mutagenetix > Incidental Mutation

Incidental Mutation 'R6899:Fzd8'

541043

Institutional Source

Beutler Lab

Gene Symbol

Fzd8

Ensembl Gene

ENSMUSG00000036904

Gene Name

frizzled class receptor 8

Synonyms

mFZ8, Fz8

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6899 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

9212856-9216201 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 9214729 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 604 (S604T)

Ref Sequence

ENSEMBL: ENSMUSP00000039660 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041080]

AlphaFold

Q61091

PDB Structure

CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MOUSE FRIZZLED 8 (MFZ8) [X-RAY DIFFRACTION]
Crystal structure of XWnt8 in complex with the cysteine-rich domain of Frizzled 8 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041080
AA Change: S604T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000039660
Gene: ENSMUSG00000036904
AA Change: S604T

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FRI	34	153	9.06e-73	SMART
low complexity region	161	228	N/A	INTRINSIC
Frizzled	264	621	1.47e-219	SMART
low complexity region	624	655	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.0%
20x: 95.9%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This gene is highly expressed in two human cancer cell lines, indicating that it may play a role in several types of cancer. The crystal structure of the extracellular cysteine-rich domain of a similar mouse protein has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F05Rik	T	C	10: 43,532,784	E121G	possibly damaging	Het
Abca16	A	G	7: 120,527,041	Y1140C	probably damaging	Het
Actl9	G	A	17: 33,433,559	G198S	probably damaging	Het
Adcy2	A	T	13: 68,982,381	M129K	probably damaging	Het
Apmap	T	A	2: 150,594,308	I107F	probably benign	Het
Arrdc3	T	C	13: 80,889,211	I162T	probably damaging	Het
Asprv1	T	C	6: 86,628,760	L196P	probably damaging	Het
Bag2	A	G	1: 33,746,831	S137P	possibly damaging	Het
Borcs5	T	A	6: 134,710,210	M177K	probably benign	Het
C8b	A	T	4: 104,786,874	K246M	probably benign	Het
Cdo1	A	G	18: 46,723,340	C76R	probably damaging	Het
Ces2b	T	A	8: 104,836,766		probably null	Het
Csf2rb	G	A	15: 78,340,702	S194N	probably benign	Het
Dap3	A	G	3: 88,933,600	F77L	probably benign	Het
Dars	A	G	1: 128,413,746	V44A	possibly damaging	Het
Dhtkd1	T	A	2: 5,917,965	D461V	possibly damaging	Het
Ero1l	A	C	14: 45,292,939	H345Q	probably benign	Het
Fam173b	A	G	15: 31,617,111	S163G	probably benign	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Gramd1c	T	A	16: 44,040,142	Y64F	probably benign	Het
Heatr5b	T	A	17: 78,803,509	Y970F	probably benign	Het
Hoxc10	A	G	15: 102,967,507	E217G	possibly damaging	Het
Hsd17b14	A	T	7: 45,562,928	H128L	possibly damaging	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ifna9	A	G	4: 88,592,063	F108S	probably damaging	Het
Ikbke	A	G	1: 131,275,762	V58A	probably damaging	Het
Inpp5e	G	A	2: 26,400,048	R462C	possibly damaging	Het
Junb	A	G	8: 84,977,724	F236L	probably benign	Het
Klhl36	T	C	8: 119,870,142	V194A	probably benign	Het
Lsg1	A	T	16: 30,582,088	D134E	probably benign	Het
Megf8	G	T	7: 25,360,713	C2343F	probably damaging	Het
Myom3	G	A	4: 135,803,292	G1172R	probably damaging	Het
Nasp	A	T	4: 116,604,333	V548E	probably damaging	Het
Nubpl	T	A	12: 52,310,753	S317T	probably benign	Het
Nup210l	A	G	3: 90,167,897	D838G	possibly damaging	Het
Oxsr1	C	T	9: 119,247,122	A373T	probably benign	Het
Psat1	C	T	19: 15,918,205		probably null	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Slain1	C	T	14: 103,650,779	P45L	possibly damaging	Het
Slc16a8	A	G	15: 79,253,749	V20A	possibly damaging	Het
Slc22a13	A	T	9: 119,196,407	M145K	probably damaging	Het
Slc22a4	G	A	11: 53,988,913	T440I	probably damaging	Het
Slc39a12	C	T	2: 14,389,541	P74L	probably damaging	Het
Sod3	A	G	5: 52,368,708	T250A	unknown	Het
Syne2	A	G	12: 76,095,729		probably null	Het
Tctn1	A	G	5: 122,248,956	Y299H	probably damaging	Het
Tfcp2l1	A	G	1: 118,675,575	M448V	probably benign	Het
Tfpi	C	T	2: 84,444,809	G152S	probably damaging	Het
Thap4	A	G	1: 93,750,969	S32P	probably damaging	Het
Tmem132c	T	A	5: 127,551,680	W549R	probably damaging	Het
Vmn2r29	T	C	7: 7,241,642	E411G	probably damaging	Het
Washc4	C	A	10: 83,576,055	D683E	probably benign	Het
Wdr3	A	T	3: 100,149,901	V462D	possibly damaging	Het
Wdr5b	T	C	16: 36,041,780	S90P	probably damaging	Het
Zfp407	A	G	18: 84,561,434	L518P	possibly damaging	Het
Zfp53	A	G	17: 21,508,445	I247V	possibly damaging	Het

Other mutations in Fzd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Fzd8	APN	18	9213068	missense	unknown
IGL01511:Fzd8	APN	18	9213293	missense	unknown
IGL03129:Fzd8	APN	18	9214270	missense	probably damaging	1.00
Stilt	UTSW	18	9213880	missense	probably damaging	1.00
R0058:Fzd8	UTSW	18	9213985	missense	possibly damaging	0.92
R0715:Fzd8	UTSW	18	9212947	missense	unknown
R0966:Fzd8	UTSW	18	9214745	missense	probably damaging	0.99
R1717:Fzd8	UTSW	18	9214364	missense	probably damaging	1.00
R1751:Fzd8	UTSW	18	9213643	missense	probably damaging	0.98
R1761:Fzd8	UTSW	18	9213643	missense	probably damaging	0.98
R1905:Fzd8	UTSW	18	9213803	missense	probably damaging	1.00
R1956:Fzd8	UTSW	18	9214502	missense	probably damaging	1.00
R2892:Fzd8	UTSW	18	9214514	missense	probably damaging	1.00
R3897:Fzd8	UTSW	18	9214939	missense	possibly damaging	0.89
R3968:Fzd8	UTSW	18	9214070	missense	probably damaging	0.98
R4934:Fzd8	UTSW	18	9214492	frame shift	probably null
R5366:Fzd8	UTSW	18	9213880	missense	probably damaging	1.00
R5624:Fzd8	UTSW	18	9213268	missense	unknown
R6261:Fzd8	UTSW	18	9214598	missense	possibly damaging	0.61
R6757:Fzd8	UTSW	18	9213238	missense	possibly damaging	0.78
R6758:Fzd8	UTSW	18	9213238	missense	possibly damaging	0.78
R7242:Fzd8	UTSW	18	9214171	missense	probably damaging	1.00
R8140:Fzd8	UTSW	18	9213797	missense	probably damaging	1.00
R8324:Fzd8	UTSW	18	9214688	missense	probably damaging	1.00
R8722:Fzd8	UTSW	18	9213686	missense	possibly damaging	0.67
R8818:Fzd8	UTSW	18	9214474	missense	probably benign	0.26
R8820:Fzd8	UTSW	18	9213247	missense	unknown
R8913:Fzd8	UTSW	18	9213869	missense	probably damaging	1.00
R9036:Fzd8	UTSW	18	9214661	missense	probably damaging	1.00
R9401:Fzd8	UTSW	18	9213205	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- GCCTTTTCTATGAGCAGCAC -3'
(R):5'- GGACAATGGCATTTGCTTAGGG -3'

Sequencing Primer
(F):5'- TTTTCTATGAGCAGCACAACCG -3'
(R):5'- CATTTGCTTAGGGTAAGATACAGAGC -3'

Posted On

2018-11-28