Incidental Mutation 'R6899:Cdo1'
ID541044
Institutional Source Beutler Lab
Gene Symbol Cdo1
Ensembl Gene ENSMUSG00000033022
Gene Namecysteine dioxygenase 1, cytosolic
SynonymsCdo, D18Ucla3, 1300002L19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R6899 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location46713205-46728342 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46723340 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 76 (C76R)
Ref Sequence ENSEMBL: ENSMUSP00000046517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035804]
PDB Structure
X-RAY STRUCTURE OF cysteine dioxygenase type I FROM MUS MUSCULUS MM.241056 [X-RAY DIFFRACTION]
Ensemble refinement of the protein crystal structure of cysteine dioxygenase type I from Mus musculus Mm.241056 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000035804
AA Change: C76R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046517
Gene: ENSMUSG00000033022
AA Change: C76R

DomainStartEndE-ValueType
Pfam:CDO_I 1 170 3e-81 PFAM
Pfam:DUF1637 26 184 9e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.9%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a deletion of this gene show increased preweaning mortality, lower body weight, behavioral defects, skeletal defects, homeostatic and reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,784 E121G possibly damaging Het
Abca16 A G 7: 120,527,041 Y1140C probably damaging Het
Actl9 G A 17: 33,433,559 G198S probably damaging Het
Adcy2 A T 13: 68,982,381 M129K probably damaging Het
Apmap T A 2: 150,594,308 I107F probably benign Het
Arrdc3 T C 13: 80,889,211 I162T probably damaging Het
Asprv1 T C 6: 86,628,760 L196P probably damaging Het
Bag2 A G 1: 33,746,831 S137P possibly damaging Het
Borcs5 T A 6: 134,710,210 M177K probably benign Het
C8b A T 4: 104,786,874 K246M probably benign Het
Ces2b T A 8: 104,836,766 probably null Het
Csf2rb G A 15: 78,340,702 S194N probably benign Het
Dap3 A G 3: 88,933,600 F77L probably benign Het
Dars A G 1: 128,413,746 V44A possibly damaging Het
Dhtkd1 T A 2: 5,917,965 D461V possibly damaging Het
Ero1l A C 14: 45,292,939 H345Q probably benign Het
Fam173b A G 15: 31,617,111 S163G probably benign Het
Fzd8 T A 18: 9,214,729 S604T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gramd1c T A 16: 44,040,142 Y64F probably benign Het
Heatr5b T A 17: 78,803,509 Y970F probably benign Het
Hoxc10 A G 15: 102,967,507 E217G possibly damaging Het
Hsd17b14 A T 7: 45,562,928 H128L possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifna9 A G 4: 88,592,063 F108S probably damaging Het
Ikbke A G 1: 131,275,762 V58A probably damaging Het
Inpp5e G A 2: 26,400,048 R462C possibly damaging Het
Junb A G 8: 84,977,724 F236L probably benign Het
Klhl36 T C 8: 119,870,142 V194A probably benign Het
Lsg1 A T 16: 30,582,088 D134E probably benign Het
Megf8 G T 7: 25,360,713 C2343F probably damaging Het
Myom3 G A 4: 135,803,292 G1172R probably damaging Het
Nasp A T 4: 116,604,333 V548E probably damaging Het
Nubpl T A 12: 52,310,753 S317T probably benign Het
Nup210l A G 3: 90,167,897 D838G possibly damaging Het
Oxsr1 C T 9: 119,247,122 A373T probably benign Het
Psat1 C T 19: 15,918,205 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Slain1 C T 14: 103,650,779 P45L possibly damaging Het
Slc16a8 A G 15: 79,253,749 V20A possibly damaging Het
Slc22a13 A T 9: 119,196,407 M145K probably damaging Het
Slc22a4 G A 11: 53,988,913 T440I probably damaging Het
Slc39a12 C T 2: 14,389,541 P74L probably damaging Het
Sod3 A G 5: 52,368,708 T250A unknown Het
Syne2 A G 12: 76,095,729 probably null Het
Tctn1 A G 5: 122,248,956 Y299H probably damaging Het
Tfcp2l1 A G 1: 118,675,575 M448V probably benign Het
Tfpi C T 2: 84,444,809 G152S probably damaging Het
Thap4 A G 1: 93,750,969 S32P probably damaging Het
Tmem132c T A 5: 127,551,680 W549R probably damaging Het
Vmn2r29 T C 7: 7,241,642 E411G probably damaging Het
Washc4 C A 10: 83,576,055 D683E probably benign Het
Wdr3 A T 3: 100,149,901 V462D possibly damaging Het
Wdr5b T C 16: 36,041,780 S90P probably damaging Het
Zfp407 A G 18: 84,561,434 L518P possibly damaging Het
Zfp53 A G 17: 21,508,445 I247V possibly damaging Het
Other mutations in Cdo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0505:Cdo1 UTSW 18 46715611 missense probably benign 0.02
R0846:Cdo1 UTSW 18 46715745 missense probably damaging 0.99
R1062:Cdo1 UTSW 18 46728063 missense probably benign 0.00
R1063:Cdo1 UTSW 18 46728063 missense probably benign 0.00
R1526:Cdo1 UTSW 18 46728063 missense probably benign 0.00
R1815:Cdo1 UTSW 18 46720302 missense probably damaging 0.99
R6317:Cdo1 UTSW 18 46728037 missense probably benign
R6996:Cdo1 UTSW 18 46720313 missense possibly damaging 0.60
R7032:Cdo1 UTSW 18 46720408 missense probably damaging 1.00
R7073:Cdo1 UTSW 18 46728199 start gained probably benign
X0064:Cdo1 UTSW 18 46720432 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTGACTCCATAGAGGTGAC -3'
(R):5'- GAAGAACATACCCTAAGCCCTATTG -3'

Sequencing Primer
(F):5'- CTCCATAGAGGTGACATAAATAAGGC -3'
(R):5'- TCCATAAAAGGGATGCTTCGAGTCC -3'
Posted On2018-11-28