Incidental Mutation 'R6925:Pdc'
ID 541051
Institutional Source Beutler Lab
Gene Symbol Pdc
Ensembl Gene ENSMUSG00000006007
Gene Name phosducin
Synonyms Pdc, Rpr1, Rpr-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R6925 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 150319417-150333906 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 150333180 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 138 (I138T)
Ref Sequence ENSEMBL: ENSMUSP00000141136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165062] [ENSMUST00000185698] [ENSMUST00000186572] [ENSMUST00000191228]
AlphaFold Q9QW08
Predicted Effect probably damaging
Transcript: ENSMUST00000165062
AA Change: I138T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131631
Gene: ENSMUSG00000006007
AA Change: I138T

DomainStartEndE-ValueType
Pfam:Phosducin 1 244 6.4e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185698
SMART Domains Protein: ENSMUSP00000140669
Gene: ENSMUSG00000006007

DomainStartEndE-ValueType
Pfam:Phosducin 1 79 2.9e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186572
AA Change: I138T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140843
Gene: ENSMUSG00000006007
AA Change: I138T

DomainStartEndE-ValueType
Pfam:Phosducin 1 185 1.6e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191228
AA Change: I138T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141136
Gene: ENSMUSG00000006007
AA Change: I138T

DomainStartEndE-ValueType
Pfam:Phosducin 1 244 6.4e-130 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoprotein, which is located in the outer and inner segments of the rod cells in the retina. This protein may participate in the regulation of visual phototransduction or in the integration of photoreceptor metabolism. It modulates the phototransduction cascade by interacting with the beta and gamma subunits of the retinal G-protein transducin. This gene is a potential candidate gene for retinitis pigmentosa and Usher syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display normal retinal morphology and rod function with reduced transducin (Gnat1) translocation. Mice homozygous for a different knock-out allele exhibit large pupils, increased blood pressure, age-related vascular smooth muscle hypertrophy, and stress-induced hypertension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,222,707 Q177R possibly damaging Het
Acat1 A T 9: 53,592,029 V170E probably benign Het
Atp2b2 T A 6: 113,760,720 I902F probably damaging Het
Cacna1d A G 14: 30,051,637 V1697A probably benign Het
Ccdc14 T A 16: 34,690,749 F31Y probably benign Het
Ccdc17 T A 4: 116,598,210 V250E probably damaging Het
Cct7 A G 6: 85,459,182 N25S probably damaging Het
Cep19 G C 16: 32,103,942 G9R probably damaging Het
Ces5a A T 8: 93,523,057 probably null Het
Chd1l T G 3: 97,582,826 E471A probably damaging Het
Chd6 A G 2: 161,013,127 I787T probably damaging Het
Cntnap5c A C 17: 58,395,266 T1194P probably benign Het
Col6a3 T A 1: 90,816,002 M208L probably benign Het
Coro7 A T 16: 4,628,674 probably null Het
Csrnp2 T C 15: 100,481,958 K484R probably benign Het
Cyp2c39 T A 19: 39,513,195 V64E probably damaging Het
Ddr2 T C 1: 169,998,132 K300E probably benign Het
Ddx56 T C 11: 6,263,980 E393G probably damaging Het
Diaph1 A C 18: 37,853,679 Y1084* probably null Het
Disp1 A T 1: 183,086,478 F1459L probably benign Het
Dnajc8 G A 4: 132,544,113 A80T probably damaging Het
Elfn1 T A 5: 139,971,685 M148K probably benign Het
Emcn T A 3: 137,419,002 I154N probably damaging Het
Enah C G 1: 181,905,898 probably null Het
Enah T A 1: 181,905,899 probably null Het
Ep300 C A 15: 81,649,981 Q2080K probably benign Het
Epha2 T A 4: 141,308,757 M168K probably benign Het
Ercc6 T A 14: 32,562,608 I776N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat4 G T 3: 38,996,204 probably null Het
G3bp1 A G 11: 55,497,960 R333G possibly damaging Het
Gm3604 A G 13: 62,369,390 F385L probably benign Het
Gm5800 T C 14: 51,713,700 I147M possibly damaging Het
Hipk1 A G 3: 103,778,245 F18S unknown Het
Ighv3-8 A T 12: 114,322,330 C131S probably benign Het
Il23r T G 6: 67,423,493 T618P probably damaging Het
Il31ra G A 13: 112,527,529 T538I possibly damaging Het
Kcns2 A G 15: 34,839,913 D474G unknown Het
Klc4 T C 17: 46,636,229 T407A possibly damaging Het
Klra5 C T 6: 129,911,457 S2N probably benign Het
Krt10 T C 11: 99,388,851 Y161C probably damaging Het
Kxd1 A T 8: 70,523,278 M1K probably null Het
Lgals1 A C 15: 78,928,040 D27A possibly damaging Het
Lgr5 T C 10: 115,466,346 S308G probably benign Het
Lrp1 G A 10: 127,556,988 S2736L probably benign Het
Lrpap1 G T 5: 35,102,536 H73N probably benign Het
Mcpt1 C A 14: 56,019,065 T86K probably damaging Het
Megf6 A T 4: 154,254,587 D527V probably damaging Het
Mical3 A T 6: 120,959,390 S1392T probably benign Het
Mmp2 A T 8: 92,839,382 D437V probably damaging Het
Mob4 T A 1: 55,152,722 Y166* probably null Het
Mrap2 G A 9: 87,182,474 M89I possibly damaging Het
Mug1 G A 6: 121,881,787 A1155T probably damaging Het
Myh2 G T 11: 67,193,218 A1556S probably benign Het
Nfatc3 A G 8: 106,119,322 D1028G probably benign Het
Ngef T G 1: 87,503,263 probably null Het
Nlrp1a A T 11: 71,092,513 L1209Q probably null Het
Npr2 C T 4: 43,647,553 R819C probably damaging Het
Nsd2 A T 5: 33,879,110 D646V probably damaging Het
Nsun7 A G 5: 66,277,072 H252R probably damaging Het
Olfr267 A T 4: 58,785,647 I25N possibly damaging Het
Olfr447 T A 6: 42,911,857 C111* probably null Het
Olfr642 C T 7: 104,049,740 V205I probably benign Het
Olfr951 A T 9: 39,393,860 Q20L probably benign Het
Olfr951 G T 9: 39,393,861 Q20H probably benign Het
Pcdhga2 A T 18: 37,670,585 D494V probably damaging Het
Pcsk2 A G 2: 143,813,747 E617G probably damaging Het
Phc2 T A 4: 128,748,134 S750T probably damaging Het
Pkd2l1 T A 19: 44,191,508 N88Y possibly damaging Het
Plcl1 C T 1: 55,406,598 R71* probably null Het
Prag1 C A 8: 36,103,894 L544M probably damaging Het
Prkg2 A G 5: 98,966,510 probably null Het
Psd2 G A 18: 35,979,711 S153N probably damaging Het
Rab11fip1 A T 8: 27,152,972 S600T probably damaging Het
Rbms1 T G 2: 60,762,304 T222P probably benign Het
Slfn8 A T 11: 83,013,417 Y382* probably null Het
Socs4 T A 14: 47,289,738 C43* probably null Het
Sorl1 T A 9: 42,033,626 T868S probably damaging Het
St6gal1 A G 16: 23,356,213 Y267C probably damaging Het
Syne1 A G 10: 5,126,682 V6879A probably benign Het
Syne2 C A 12: 75,854,132 H22N possibly damaging Het
Tmeff2 T A 1: 50,928,021 L25Q probably damaging Het
Tmprss11g G T 5: 86,487,426 D396E probably benign Het
Tmprss11g T A 5: 86,487,436 H393L probably benign Het
Vmn2r23 A G 6: 123,704,553 E140G probably damaging Het
Wapl T C 14: 34,677,363 S130P probably benign Het
Zeb2 T A 2: 44,994,529 K982M probably damaging Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp719 T C 7: 43,590,706 S573P probably damaging Het
Zfp979 A T 4: 147,613,542 C237S possibly damaging Het
Other mutations in Pdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Pdc APN 1 150333255 missense probably damaging 0.99
IGL02537:Pdc APN 1 150333009 missense possibly damaging 0.68
R0349:Pdc UTSW 1 150333427 missense probably benign 0.07
R0502:Pdc UTSW 1 150328414 splice site probably benign
R1167:Pdc UTSW 1 150333245 missense probably damaging 1.00
R1717:Pdc UTSW 1 150333141 missense probably damaging 1.00
R5182:Pdc UTSW 1 150333354 missense possibly damaging 0.84
R5449:Pdc UTSW 1 150333439 missense probably damaging 1.00
R5766:Pdc UTSW 1 150333500 makesense probably null
R6020:Pdc UTSW 1 150333366 missense probably benign 0.16
R6181:Pdc UTSW 1 150333270 missense probably damaging 1.00
R6425:Pdc UTSW 1 150333372 missense probably benign 0.37
R6660:Pdc UTSW 1 150333335 missense probably damaging 1.00
R6717:Pdc UTSW 1 150333018 missense probably damaging 1.00
R7716:Pdc UTSW 1 150330783 missense probably benign 0.06
R7820:Pdc UTSW 1 150333270 missense probably damaging 1.00
R8030:Pdc UTSW 1 150333213 missense probably damaging 1.00
R9495:Pdc UTSW 1 150333168 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCGTTCTCAGATGAGCATTCAAG -3'
(R):5'- TAAAATTGCTTATGAGTTCCCCACC -3'

Sequencing Primer
(F):5'- TCTCAGATGAGCATTCAAGAATATG -3'
(R):5'- CTTTGTACACCAGCAACGTAGGG -3'
Posted On 2018-11-28