Incidental Mutation 'R6925:Enah'
ID541053
Institutional Source Beutler Lab
Gene Symbol Enah
Ensembl Gene ENSMUSG00000022995
Gene NameENAH actin regulator
SynonymsNdpp1, Mena
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R6925 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location181896384-182019990 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to G at 181905898 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078719] [ENSMUST00000111024] [ENSMUST00000111025] [ENSMUST00000111030] [ENSMUST00000177811] [ENSMUST00000193074] [ENSMUST00000193703] [ENSMUST00000195059]
Predicted Effect probably null
Transcript: ENSMUST00000078719
SMART Domains Protein: ENSMUSP00000077781
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 154 258 N/A INTRINSIC
low complexity region 274 285 N/A INTRINSIC
low complexity region 308 317 N/A INTRINSIC
internal_repeat_1 354 366 4.73e-6 PROSPERO
low complexity region 373 392 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
low complexity region 430 471 N/A INTRINSIC
low complexity region 487 507 N/A INTRINSIC
low complexity region 542 609 N/A INTRINSIC
low complexity region 665 678 N/A INTRINSIC
internal_repeat_1 746 758 4.73e-6 PROSPERO
Pfam:VASP_tetra 765 801 1.7e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111024
SMART Domains Protein: ENSMUSP00000106653
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 239 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
internal_repeat_1 335 347 3.85e-6 PROSPERO
low complexity region 354 373 N/A INTRINSIC
low complexity region 379 401 N/A INTRINSIC
low complexity region 411 452 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
low complexity region 523 590 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
internal_repeat_1 727 739 3.85e-6 PROSPERO
Pfam:VASP_tetra 745 784 1.4e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111025
SMART Domains Protein: ENSMUSP00000106654
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 240 N/A INTRINSIC
low complexity region 279 313 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
Pfam:VASP_tetra 467 506 2.3e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111030
SMART Domains Protein: ENSMUSP00000106659
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 139 243 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 293 302 N/A INTRINSIC
internal_repeat_1 339 351 3.87e-6 PROSPERO
low complexity region 358 377 N/A INTRINSIC
low complexity region 383 405 N/A INTRINSIC
low complexity region 415 456 N/A INTRINSIC
low complexity region 472 492 N/A INTRINSIC
low complexity region 527 594 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
internal_repeat_1 731 743 3.87e-6 PROSPERO
Pfam:VASP_tetra 749 788 1.4e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177811
SMART Domains Protein: ENSMUSP00000136863
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 139 243 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 293 302 N/A INTRINSIC
internal_repeat_1 339 351 4.25e-6 PROSPERO
low complexity region 358 377 N/A INTRINSIC
low complexity region 383 405 N/A INTRINSIC
low complexity region 415 456 N/A INTRINSIC
low complexity region 472 492 N/A INTRINSIC
low complexity region 527 594 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
internal_repeat_1 731 743 4.25e-6 PROSPERO
Pfam:VASP_tetra 749 788 2.2e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000193074
SMART Domains Protein: ENSMUSP00000141936
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
RanBD 7 127 1.5e-4 SMART
WH1 21 128 2.8e-47 SMART
coiled coil region 155 260 N/A INTRINSIC
low complexity region 262 329 N/A INTRINSIC
low complexity region 385 398 N/A INTRINSIC
Pfam:VASP_tetra 484 523 1.8e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000193703
SMART Domains Protein: ENSMUSP00000141462
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 240 N/A INTRINSIC
low complexity region 279 346 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
Pfam:VASP_tetra 501 540 2.5e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000195059
SMART Domains Protein: ENSMUSP00000141344
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 239 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
internal_repeat_1 335 347 3.85e-6 PROSPERO
low complexity region 354 373 N/A INTRINSIC
low complexity region 379 401 N/A INTRINSIC
low complexity region 411 452 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
low complexity region 523 590 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
internal_repeat_1 727 739 3.85e-6 PROSPERO
Pfam:VASP_tetra 745 784 1.4e-23 PFAM
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the enabled/ vasodilator-stimulated phosphoprotein. Members of this gene family are involved in actin-based motility. This protein is involved in regulating the assembly of actin filaments and modulates cell adhesion and motility. Alternate splice variants of this gene have been correlated with tumor invasiveness in certain tissues and these variants may serve as prognostic markers. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a targeted mutation show defects in major axonal projection pathways in brain, including malformation of the hippocampal commissure and pontocerebellar fibers and frequent agenesis of the corpus callosum due to a failure of axons to project across the midline during development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,222,707 Q177R possibly damaging Het
Acat1 A T 9: 53,592,029 V170E probably benign Het
Atp2b2 T A 6: 113,760,720 I902F probably damaging Het
Cacna1d A G 14: 30,051,637 V1697A probably benign Het
Ccdc14 T A 16: 34,690,749 F31Y probably benign Het
Ccdc17 T A 4: 116,598,210 V250E probably damaging Het
Cct7 A G 6: 85,459,182 N25S probably damaging Het
Cep19 G C 16: 32,103,942 G9R probably damaging Het
Ces5a A T 8: 93,523,057 probably null Het
Chd1l T G 3: 97,582,826 E471A probably damaging Het
Chd6 A G 2: 161,013,127 I787T probably damaging Het
Cntnap5c A C 17: 58,395,266 T1194P probably benign Het
Col6a3 T A 1: 90,816,002 M208L probably benign Het
Coro7 A T 16: 4,628,674 probably null Het
Csrnp2 T C 15: 100,481,958 K484R probably benign Het
Cyp2c39 T A 19: 39,513,195 V64E probably damaging Het
Ddr2 T C 1: 169,998,132 K300E probably benign Het
Ddx56 T C 11: 6,263,980 E393G probably damaging Het
Diaph1 A C 18: 37,853,679 Y1084* probably null Het
Disp1 A T 1: 183,086,478 F1459L probably benign Het
Dnajc8 G A 4: 132,544,113 A80T probably damaging Het
Elfn1 T A 5: 139,971,685 M148K probably benign Het
Emcn T A 3: 137,419,002 I154N probably damaging Het
Ep300 C A 15: 81,649,981 Q2080K probably benign Het
Epha2 T A 4: 141,308,757 M168K probably benign Het
Ercc6 T A 14: 32,562,608 I776N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat4 G T 3: 38,996,204 probably null Het
G3bp1 A G 11: 55,497,960 R333G possibly damaging Het
Gm3604 A G 13: 62,369,390 F385L probably benign Het
Gm5800 T C 14: 51,713,700 I147M possibly damaging Het
Hipk1 A G 3: 103,778,245 F18S unknown Het
Ighv3-8 A T 12: 114,322,330 C131S probably benign Het
Il23r T G 6: 67,423,493 T618P probably damaging Het
Il31ra G A 13: 112,527,529 T538I possibly damaging Het
Kcns2 A G 15: 34,839,913 D474G unknown Het
Klc4 T C 17: 46,636,229 T407A possibly damaging Het
Klra5 C T 6: 129,911,457 S2N probably benign Het
Krt10 T C 11: 99,388,851 Y161C probably damaging Het
Kxd1 A T 8: 70,523,278 M1K probably null Het
Lgals1 A C 15: 78,928,040 D27A possibly damaging Het
Lgr5 T C 10: 115,466,346 S308G probably benign Het
Lrp1 G A 10: 127,556,988 S2736L probably benign Het
Lrpap1 G T 5: 35,102,536 H73N probably benign Het
Mcpt1 C A 14: 56,019,065 T86K probably damaging Het
Megf6 A T 4: 154,254,587 D527V probably damaging Het
Mical3 A T 6: 120,959,390 S1392T probably benign Het
Mmp2 A T 8: 92,839,382 D437V probably damaging Het
Mob4 T A 1: 55,152,722 Y166* probably null Het
Mrap2 G A 9: 87,182,474 M89I possibly damaging Het
Mug1 G A 6: 121,881,787 A1155T probably damaging Het
Myh2 G T 11: 67,193,218 A1556S probably benign Het
Nfatc3 A G 8: 106,119,322 D1028G probably benign Het
Ngef T G 1: 87,503,263 probably null Het
Nlrp1a A T 11: 71,092,513 L1209Q probably null Het
Npr2 C T 4: 43,647,553 R819C probably damaging Het
Nsd2 A T 5: 33,879,110 D646V probably damaging Het
Nsun7 A G 5: 66,277,072 H252R probably damaging Het
Olfr267 A T 4: 58,785,647 I25N possibly damaging Het
Olfr447 T A 6: 42,911,857 C111* probably null Het
Olfr642 C T 7: 104,049,740 V205I probably benign Het
Olfr951 A T 9: 39,393,860 Q20L probably benign Het
Olfr951 G T 9: 39,393,861 Q20H probably benign Het
Pcdhga2 A T 18: 37,670,585 D494V probably damaging Het
Pcsk2 A G 2: 143,813,747 E617G probably damaging Het
Pdc T C 1: 150,333,180 I138T probably damaging Het
Phc2 T A 4: 128,748,134 S750T probably damaging Het
Pkd2l1 T A 19: 44,191,508 N88Y possibly damaging Het
Plcl1 C T 1: 55,406,598 R71* probably null Het
Prag1 C A 8: 36,103,894 L544M probably damaging Het
Prkg2 A G 5: 98,966,510 probably null Het
Psd2 G A 18: 35,979,711 S153N probably damaging Het
Rab11fip1 A T 8: 27,152,972 S600T probably damaging Het
Rbms1 T G 2: 60,762,304 T222P probably benign Het
Slfn8 A T 11: 83,013,417 Y382* probably null Het
Socs4 T A 14: 47,289,738 C43* probably null Het
Sorl1 T A 9: 42,033,626 T868S probably damaging Het
St6gal1 A G 16: 23,356,213 Y267C probably damaging Het
Syne1 A G 10: 5,126,682 V6879A probably benign Het
Syne2 C A 12: 75,854,132 H22N possibly damaging Het
Tmeff2 T A 1: 50,928,021 L25Q probably damaging Het
Tmprss11g G T 5: 86,487,426 D396E probably benign Het
Tmprss11g T A 5: 86,487,436 H393L probably benign Het
Vmn2r23 A G 6: 123,704,553 E140G probably damaging Het
Wapl T C 14: 34,677,363 S130P probably benign Het
Zeb2 T A 2: 44,994,529 K982M probably damaging Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp719 T C 7: 43,590,706 S573P probably damaging Het
Zfp979 A T 4: 147,613,542 C237S possibly damaging Het
Other mutations in Enah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Enah APN 1 181935696 intron probably benign
IGL01996:Enah APN 1 181956505 missense unknown
R0025:Enah UTSW 1 181913373 missense possibly damaging 0.53
R0612:Enah UTSW 1 181906448 splice site probably benign
R1005:Enah UTSW 1 181961930 splice site probably benign
R1075:Enah UTSW 1 181956501 missense unknown
R1589:Enah UTSW 1 181922293 missense probably damaging 1.00
R1601:Enah UTSW 1 181919620 nonsense probably null
R1607:Enah UTSW 1 181917197 critical splice donor site probably null
R1785:Enah UTSW 1 181956429 missense unknown
R2035:Enah UTSW 1 181921972 missense probably damaging 1.00
R2037:Enah UTSW 1 181921972 missense probably damaging 1.00
R2119:Enah UTSW 1 181921753 missense probably damaging 0.98
R2180:Enah UTSW 1 181918459 missense probably damaging 1.00
R2233:Enah UTSW 1 181921972 missense probably damaging 1.00
R4348:Enah UTSW 1 181922420 missense possibly damaging 0.94
R4350:Enah UTSW 1 181922420 missense possibly damaging 0.94
R4576:Enah UTSW 1 181919563 missense possibly damaging 0.79
R4956:Enah UTSW 1 181918289 missense probably damaging 0.98
R5230:Enah UTSW 1 181935670 intron probably benign
R5282:Enah UTSW 1 181935728 splice site probably null
R5505:Enah UTSW 1 181906453 splice site probably benign
R5813:Enah UTSW 1 181931185 intron probably benign
R6324:Enah UTSW 1 181918571 missense probably damaging 1.00
R6374:Enah UTSW 1 181923580 missense unknown
R6503:Enah UTSW 1 181918511 missense probably damaging 1.00
R6513:Enah UTSW 1 182014355 intron probably benign
R6925:Enah UTSW 1 181905899 critical splice acceptor site probably null
R7184:Enah UTSW 1 181922392 missense probably damaging 0.99
R7308:Enah UTSW 1 181906385 critical splice donor site probably null
R7453:Enah UTSW 1 181961905 missense unknown
R7759:Enah UTSW 1 181918444 missense unknown
RF024:Enah UTSW 1 181921934 frame shift probably null
RF032:Enah UTSW 1 181921929 frame shift probably null
RF038:Enah UTSW 1 181921935 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTCAGAGGTTGACGGCTTCC -3'
(R):5'- TTTGAGCCCACAGAACCAG -3'

Sequencing Primer
(F):5'- GGTTGACGGCTTCCCTCCTG -3'
(R):5'- TCCTGTCTTAAATCTACAAGGGAGGG -3'
Posted On2018-11-28