Incidental Mutation 'R6925:Zeb2'
ID541056
Institutional Source Beutler Lab
Gene Symbol Zeb2
Ensembl Gene ENSMUSG00000026872
Gene Namezinc finger E-box binding homeobox 2
SynonymsZfhx1b, Zfx1b, SIP1, 9130203F04Rik, D130016B08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6925 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location44983632-45117395 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44994529 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 982 (K982M)
Ref Sequence ENSEMBL: ENSMUSP00000144421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028229] [ENSMUST00000068415] [ENSMUST00000076836] [ENSMUST00000176438] [ENSMUST00000176732] [ENSMUST00000177302] [ENSMUST00000200844] [ENSMUST00000201804]
Predicted Effect probably damaging
Transcript: ENSMUST00000028229
AA Change: K1050M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028229
Gene: ENSMUSG00000026872
AA Change: K1050M

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068415
AA Change: K1006M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069685
Gene: ENSMUSG00000026872
AA Change: K1006M

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000076836
AA Change: K1005M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076111
Gene: ENSMUSG00000026872
AA Change: K1005M

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 210 233 2.09e-3 SMART
ZnF_C2H2 240 262 9.88e-5 SMART
ZnF_C2H2 281 303 4.87e-4 SMART
ZnF_C2H2 309 329 1.86e1 SMART
low complexity region 351 363 N/A INTRINSIC
ZnF_C2H2 580 600 5.54e1 SMART
HOX 643 705 2.05e-3 SMART
low complexity region 777 807 N/A INTRINSIC
low complexity region 840 855 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
ZnF_C2H2 998 1020 4.47e-3 SMART
ZnF_C2H2 1026 1048 2.17e-1 SMART
ZnF_C2H2 1054 1075 1.89e-1 SMART
low complexity region 1082 1096 N/A INTRINSIC
low complexity region 1133 1149 N/A INTRINSIC
low complexity region 1157 1167 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176438
AA Change: K1006M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134849
Gene: ENSMUSG00000026872
AA Change: K1006M

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176732
SMART Domains Protein: ENSMUSP00000135393
Gene: ENSMUSG00000026872

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
ZnF_C2H2 60 83 2.09e-3 SMART
ZnF_C2H2 90 112 9.88e-5 SMART
ZnF_C2H2 131 153 4.87e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177302
AA Change: K1006M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134747
Gene: ENSMUSG00000026872
AA Change: K1006M

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200844
AA Change: K982M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144421
Gene: ENSMUSG00000026872
AA Change: K982M

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 187 210 9.2e-6 SMART
ZnF_C2H2 217 239 4.2e-7 SMART
ZnF_C2H2 258 280 2e-6 SMART
ZnF_C2H2 286 306 8e-2 SMART
low complexity region 328 340 N/A INTRINSIC
ZnF_C2H2 557 577 2.4e-1 SMART
HOX 620 682 1.1e-5 SMART
low complexity region 754 784 N/A INTRINSIC
low complexity region 817 832 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
ZnF_C2H2 975 997 1.9e-5 SMART
ZnF_C2H2 1003 1025 9.6e-4 SMART
ZnF_C2H2 1031 1052 7.9e-4 SMART
low complexity region 1059 1073 N/A INTRINSIC
low complexity region 1110 1126 N/A INTRINSIC
low complexity region 1134 1144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201804
SMART Domains Protein: ENSMUSP00000144637
Gene: ENSMUSG00000026872

DomainStartEndE-ValueType
low complexity region 107 119 N/A INTRINSIC
ZnF_C2H2 240 263 9.2e-6 SMART
ZnF_C2H2 270 292 4.2e-7 SMART
ZnF_C2H2 311 333 2e-6 SMART
ZnF_C2H2 339 359 8e-2 SMART
low complexity region 381 393 N/A INTRINSIC
ZnF_C2H2 610 630 2.4e-1 SMART
HOX 673 731 1.2e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Zfh1 family of 2-handed zinc finger/homeodomain proteins. It is located in the nucleus and functions as a DNA-binding transcriptional repressor that interacts with activated SMADs. Mutations in this gene are associated with Hirschsprung disease/Mowat-Wilson syndrome. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous null mutants exhibit a variety of defects at embryonic day 8.5 and die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,222,707 Q177R possibly damaging Het
Acat1 A T 9: 53,592,029 V170E probably benign Het
Atp2b2 T A 6: 113,760,720 I902F probably damaging Het
Cacna1d A G 14: 30,051,637 V1697A probably benign Het
Ccdc14 T A 16: 34,690,749 F31Y probably benign Het
Ccdc17 T A 4: 116,598,210 V250E probably damaging Het
Cct7 A G 6: 85,459,182 N25S probably damaging Het
Cep19 G C 16: 32,103,942 G9R probably damaging Het
Ces5a A T 8: 93,523,057 probably null Het
Chd1l T G 3: 97,582,826 E471A probably damaging Het
Chd6 A G 2: 161,013,127 I787T probably damaging Het
Cntnap5c A C 17: 58,395,266 T1194P probably benign Het
Col6a3 T A 1: 90,816,002 M208L probably benign Het
Coro7 A T 16: 4,628,674 probably null Het
Csrnp2 T C 15: 100,481,958 K484R probably benign Het
Cyp2c39 T A 19: 39,513,195 V64E probably damaging Het
Ddr2 T C 1: 169,998,132 K300E probably benign Het
Ddx56 T C 11: 6,263,980 E393G probably damaging Het
Diaph1 A C 18: 37,853,679 Y1084* probably null Het
Disp1 A T 1: 183,086,478 F1459L probably benign Het
Dnajc8 G A 4: 132,544,113 A80T probably damaging Het
Elfn1 T A 5: 139,971,685 M148K probably benign Het
Emcn T A 3: 137,419,002 I154N probably damaging Het
Enah C G 1: 181,905,898 probably null Het
Enah T A 1: 181,905,899 probably null Het
Ep300 C A 15: 81,649,981 Q2080K probably benign Het
Epha2 T A 4: 141,308,757 M168K probably benign Het
Ercc6 T A 14: 32,562,608 I776N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat4 G T 3: 38,996,204 probably null Het
G3bp1 A G 11: 55,497,960 R333G possibly damaging Het
Gm3604 A G 13: 62,369,390 F385L probably benign Het
Gm5800 T C 14: 51,713,700 I147M possibly damaging Het
Hipk1 A G 3: 103,778,245 F18S unknown Het
Ighv3-8 A T 12: 114,322,330 C131S probably benign Het
Il23r T G 6: 67,423,493 T618P probably damaging Het
Il31ra G A 13: 112,527,529 T538I possibly damaging Het
Kcns2 A G 15: 34,839,913 D474G unknown Het
Klc4 T C 17: 46,636,229 T407A possibly damaging Het
Klra5 C T 6: 129,911,457 S2N probably benign Het
Krt10 T C 11: 99,388,851 Y161C probably damaging Het
Kxd1 A T 8: 70,523,278 M1K probably null Het
Lgals1 A C 15: 78,928,040 D27A possibly damaging Het
Lgr5 T C 10: 115,466,346 S308G probably benign Het
Lrp1 G A 10: 127,556,988 S2736L probably benign Het
Lrpap1 G T 5: 35,102,536 H73N probably benign Het
Mcpt1 C A 14: 56,019,065 T86K probably damaging Het
Megf6 A T 4: 154,254,587 D527V probably damaging Het
Mical3 A T 6: 120,959,390 S1392T probably benign Het
Mmp2 A T 8: 92,839,382 D437V probably damaging Het
Mob4 T A 1: 55,152,722 Y166* probably null Het
Mrap2 G A 9: 87,182,474 M89I possibly damaging Het
Mug1 G A 6: 121,881,787 A1155T probably damaging Het
Myh2 G T 11: 67,193,218 A1556S probably benign Het
Nfatc3 A G 8: 106,119,322 D1028G probably benign Het
Ngef T G 1: 87,503,263 probably null Het
Nlrp1a A T 11: 71,092,513 L1209Q probably null Het
Npr2 C T 4: 43,647,553 R819C probably damaging Het
Nsd2 A T 5: 33,879,110 D646V probably damaging Het
Nsun7 A G 5: 66,277,072 H252R probably damaging Het
Olfr267 A T 4: 58,785,647 I25N possibly damaging Het
Olfr447 T A 6: 42,911,857 C111* probably null Het
Olfr642 C T 7: 104,049,740 V205I probably benign Het
Olfr951 A T 9: 39,393,860 Q20L probably benign Het
Olfr951 G T 9: 39,393,861 Q20H probably benign Het
Pcdhga2 A T 18: 37,670,585 D494V probably damaging Het
Pcsk2 A G 2: 143,813,747 E617G probably damaging Het
Pdc T C 1: 150,333,180 I138T probably damaging Het
Phc2 T A 4: 128,748,134 S750T probably damaging Het
Pkd2l1 T A 19: 44,191,508 N88Y possibly damaging Het
Plcl1 C T 1: 55,406,598 R71* probably null Het
Prag1 C A 8: 36,103,894 L544M probably damaging Het
Prkg2 A G 5: 98,966,510 probably null Het
Psd2 G A 18: 35,979,711 S153N probably damaging Het
Rab11fip1 A T 8: 27,152,972 S600T probably damaging Het
Rbms1 T G 2: 60,762,304 T222P probably benign Het
Slfn8 A T 11: 83,013,417 Y382* probably null Het
Socs4 T A 14: 47,289,738 C43* probably null Het
Sorl1 T A 9: 42,033,626 T868S probably damaging Het
St6gal1 A G 16: 23,356,213 Y267C probably damaging Het
Syne1 A G 10: 5,126,682 V6879A probably benign Het
Syne2 C A 12: 75,854,132 H22N possibly damaging Het
Tmeff2 T A 1: 50,928,021 L25Q probably damaging Het
Tmprss11g G T 5: 86,487,426 D396E probably benign Het
Tmprss11g T A 5: 86,487,436 H393L probably benign Het
Vmn2r23 A G 6: 123,704,553 E140G probably damaging Het
Wapl T C 14: 34,677,363 S130P probably benign Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp719 T C 7: 43,590,706 S573P probably damaging Het
Zfp979 A T 4: 147,613,542 C237S possibly damaging Het
Other mutations in Zeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Zeb2 APN 2 44997275 missense probably damaging 1.00
IGL01639:Zeb2 APN 2 44997257 missense probably benign
IGL02016:Zeb2 APN 2 44988874 missense possibly damaging 0.71
IGL02337:Zeb2 APN 2 44997230 missense probably damaging 0.96
IGL02745:Zeb2 APN 2 44994475 unclassified probably benign
IGL02893:Zeb2 APN 2 44996607 missense probably benign 0.03
IGL03412:Zeb2 APN 2 45002708 intron probably benign
Dropped UTSW 2 45110041 missense possibly damaging 0.66
Okapi UTSW 2 44997156 missense probably damaging 1.00
sable UTSW 2 44997318 missense probably damaging 1.00
R0514:Zeb2 UTSW 2 45002647 missense possibly damaging 0.52
R0603:Zeb2 UTSW 2 45017426 missense probably benign 0.45
R0608:Zeb2 UTSW 2 44996126 missense possibly damaging 0.87
R1236:Zeb2 UTSW 2 44994646 missense probably damaging 1.00
R1529:Zeb2 UTSW 2 44997194 missense probably damaging 1.00
R1581:Zeb2 UTSW 2 44997000 missense probably damaging 0.99
R1636:Zeb2 UTSW 2 45002611 missense probably damaging 1.00
R1924:Zeb2 UTSW 2 45002612 missense probably damaging 1.00
R2012:Zeb2 UTSW 2 44997950 missense probably damaging 1.00
R2097:Zeb2 UTSW 2 44997156 missense probably damaging 1.00
R2156:Zeb2 UTSW 2 44988809 missense probably benign 0.20
R4385:Zeb2 UTSW 2 45023062 missense probably damaging 1.00
R4472:Zeb2 UTSW 2 45023011 missense probably damaging 1.00
R4678:Zeb2 UTSW 2 44996341 missense probably damaging 0.99
R4769:Zeb2 UTSW 2 44996435 missense probably damaging 1.00
R4816:Zeb2 UTSW 2 44997768 missense probably damaging 0.99
R4918:Zeb2 UTSW 2 44996882 missense probably damaging 1.00
R4969:Zeb2 UTSW 2 44998919 missense probably damaging 1.00
R5191:Zeb2 UTSW 2 45002600 missense probably benign 0.00
R5195:Zeb2 UTSW 2 45001635 missense probably damaging 1.00
R5322:Zeb2 UTSW 2 44997095 missense probably damaging 1.00
R5699:Zeb2 UTSW 2 44997788 missense probably damaging 1.00
R5750:Zeb2 UTSW 2 44997518 missense probably damaging 0.96
R5764:Zeb2 UTSW 2 44996919 missense possibly damaging 0.89
R5914:Zeb2 UTSW 2 44997052 missense probably benign 0.00
R5918:Zeb2 UTSW 2 45111259 intron probably benign
R6037:Zeb2 UTSW 2 44988640 nonsense probably null
R6037:Zeb2 UTSW 2 44988640 nonsense probably null
R6302:Zeb2 UTSW 2 44997759 missense probably benign 0.18
R6372:Zeb2 UTSW 2 45002539 missense probably damaging 1.00
R6402:Zeb2 UTSW 2 44996975 missense probably damaging 1.00
R6492:Zeb2 UTSW 2 45110496 intron probably benign
R6554:Zeb2 UTSW 2 44997512 missense probably damaging 1.00
R6675:Zeb2 UTSW 2 44997445 nonsense probably null
R6735:Zeb2 UTSW 2 45110016 missense probably null 0.99
R6870:Zeb2 UTSW 2 44988910 missense probably damaging 0.98
R6963:Zeb2 UTSW 2 44988799 missense probably damaging 0.97
R6972:Zeb2 UTSW 2 44997318 missense probably damaging 1.00
R7144:Zeb2 UTSW 2 45110041 missense possibly damaging 0.66
R7178:Zeb2 UTSW 2 44996994 missense probably damaging 0.97
R7379:Zeb2 UTSW 2 45001817 splice site probably null
R7419:Zeb2 UTSW 2 44996347 missense probably benign 0.20
R7580:Zeb2 UTSW 2 44994532 missense probably damaging 1.00
R7599:Zeb2 UTSW 2 44994613 missense probably damaging 1.00
R7625:Zeb2 UTSW 2 45002572 missense probably damaging 1.00
R7917:Zeb2 UTSW 2 44996409 missense possibly damaging 0.50
R8132:Zeb2 UTSW 2 44989130 missense probably damaging 1.00
R8412:Zeb2 UTSW 2 44998952 missense probably damaging 1.00
R8413:Zeb2 UTSW 2 44996171 missense probably damaging 0.99
R8417:Zeb2 UTSW 2 45022996 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACAAAAGTCCTACTGAGTTATGC -3'
(R):5'- GATCTCTAGTTGTCAGCCTATGC -3'

Sequencing Primer
(F):5'- AAAGTCCTACTGAGTTATGCAAAAG -3'
(R):5'- TTTGATGTAAACACAAAGAGGAGAG -3'
Posted On2018-11-28