Mutagenetix > Incidental Mutation

Incidental Mutation 'R6925:Chd6'

541059

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

6330406J24Rik, 5430439G14Rik

MMRRC Submission

045043-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.687) question?

Stock #

R6925 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

160946978-161109075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 161013127 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 787 (I787T)

Ref Sequence

ENSEMBL: ENSMUSP00000042291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000134178]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000039782
AA Change: I787T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: I787T

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133
AA Change: I786T

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	213	228	N/A	INTRINSIC
CHROMO	288	354	1.35e-4	SMART
CHROMO	371	429	3.48e-7	SMART
DEXDc	455	657	1.73e-39	SMART
HELICc	811	895	3.84e-23	SMART
low complexity region	1079	1093	N/A	INTRINSIC
Blast:DEXDc	1107	1152	4e-23	BLAST

Meta Mutation Damage Score

0.8341

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	G	7: 131,222,707	Q177R	possibly damaging	Het
Acat1	A	T	9: 53,592,029	V170E	probably benign	Het
Atp2b2	T	A	6: 113,760,720	I902F	probably damaging	Het
Cacna1d	A	G	14: 30,051,637	V1697A	probably benign	Het
Ccdc14	T	A	16: 34,690,749	F31Y	probably benign	Het
Ccdc17	T	A	4: 116,598,210	V250E	probably damaging	Het
Cct7	A	G	6: 85,459,182	N25S	probably damaging	Het
Cep19	G	C	16: 32,103,942	G9R	probably damaging	Het
Ces5a	A	T	8: 93,523,057		probably null	Het
Chd1l	T	G	3: 97,582,826	E471A	probably damaging	Het
Cntnap5c	A	C	17: 58,395,266	T1194P	probably benign	Het
Col6a3	T	A	1: 90,816,002	M208L	probably benign	Het
Coro7	A	T	16: 4,628,674		probably null	Het
Csrnp2	T	C	15: 100,481,958	K484R	probably benign	Het
Cyp2c39	T	A	19: 39,513,195	V64E	probably damaging	Het
Ddr2	T	C	1: 169,998,132	K300E	probably benign	Het
Ddx56	T	C	11: 6,263,980	E393G	probably damaging	Het
Diaph1	A	C	18: 37,853,679	Y1084*	probably null	Het
Disp1	A	T	1: 183,086,478	F1459L	probably benign	Het
Dnajc8	G	A	4: 132,544,113	A80T	probably damaging	Het
Elfn1	T	A	5: 139,971,685	M148K	probably benign	Het
Emcn	T	A	3: 137,419,002	I154N	probably damaging	Het
Enah	C	G	1: 181,905,898		probably null	Het
Enah	T	A	1: 181,905,899		probably null	Het
Ep300	C	A	15: 81,649,981	Q2080K	probably benign	Het
Epha2	T	A	4: 141,308,757	M168K	probably benign	Het
Ercc6	T	A	14: 32,562,608	I776N	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fat4	G	T	3: 38,996,204		probably null	Het
G3bp1	A	G	11: 55,497,960	R333G	possibly damaging	Het
Gm3604	A	G	13: 62,369,390	F385L	probably benign	Het
Gm5800	T	C	14: 51,713,700	I147M	possibly damaging	Het
Hipk1	A	G	3: 103,778,245	F18S	unknown	Het
Ighv3-8	A	T	12: 114,322,330	C131S	probably benign	Het
Il23r	T	G	6: 67,423,493	T618P	probably damaging	Het
Il31ra	G	A	13: 112,527,529	T538I	possibly damaging	Het
Kcns2	A	G	15: 34,839,913	D474G	unknown	Het
Klc4	T	C	17: 46,636,229	T407A	possibly damaging	Het
Klra5	C	T	6: 129,911,457	S2N	probably benign	Het
Krt10	T	C	11: 99,388,851	Y161C	probably damaging	Het
Kxd1	A	T	8: 70,523,278	M1K	probably null	Het
Lgals1	A	C	15: 78,928,040	D27A	possibly damaging	Het
Lgr5	T	C	10: 115,466,346	S308G	probably benign	Het
Lrp1	G	A	10: 127,556,988	S2736L	probably benign	Het
Lrpap1	G	T	5: 35,102,536	H73N	probably benign	Het
Mcpt1	C	A	14: 56,019,065	T86K	probably damaging	Het
Megf6	A	T	4: 154,254,587	D527V	probably damaging	Het
Mical3	A	T	6: 120,959,390	S1392T	probably benign	Het
Mmp2	A	T	8: 92,839,382	D437V	probably damaging	Het
Mob4	T	A	1: 55,152,722	Y166*	probably null	Het
Mrap2	G	A	9: 87,182,474	M89I	possibly damaging	Het
Mug1	G	A	6: 121,881,787	A1155T	probably damaging	Het
Myh2	G	T	11: 67,193,218	A1556S	probably benign	Het
Nfatc3	A	G	8: 106,119,322	D1028G	probably benign	Het
Ngef	T	G	1: 87,503,263		probably null	Het
Nlrp1a	A	T	11: 71,092,513	L1209Q	probably null	Het
Npr2	C	T	4: 43,647,553	R819C	probably damaging	Het
Nsd2	A	T	5: 33,879,110	D646V	probably damaging	Het
Nsun7	A	G	5: 66,277,072	H252R	probably damaging	Het
Olfr267	A	T	4: 58,785,647	I25N	possibly damaging	Het
Olfr447	T	A	6: 42,911,857	C111*	probably null	Het
Olfr642	C	T	7: 104,049,740	V205I	probably benign	Het
Olfr951	A	T	9: 39,393,860	Q20L	probably benign	Het
Olfr951	G	T	9: 39,393,861	Q20H	probably benign	Het
Pcdhga2	A	T	18: 37,670,585	D494V	probably damaging	Het
Pcsk2	A	G	2: 143,813,747	E617G	probably damaging	Het
Pdc	T	C	1: 150,333,180	I138T	probably damaging	Het
Phc2	T	A	4: 128,748,134	S750T	probably damaging	Het
Pkd2l1	T	A	19: 44,191,508	N88Y	possibly damaging	Het
Plcl1	C	T	1: 55,406,598	R71*	probably null	Het
Prag1	C	A	8: 36,103,894	L544M	probably damaging	Het
Prkg2	A	G	5: 98,966,510		probably null	Het
Psd2	G	A	18: 35,979,711	S153N	probably damaging	Het
Rab11fip1	A	T	8: 27,152,972	S600T	probably damaging	Het
Rbms1	T	G	2: 60,762,304	T222P	probably benign	Het
Slfn8	A	T	11: 83,013,417	Y382*	probably null	Het
Socs4	T	A	14: 47,289,738	C43*	probably null	Het
Sorl1	T	A	9: 42,033,626	T868S	probably damaging	Het
St6gal1	A	G	16: 23,356,213	Y267C	probably damaging	Het
Syne1	A	G	10: 5,126,682	V6879A	probably benign	Het
Syne2	C	A	12: 75,854,132	H22N	possibly damaging	Het
Tmeff2	T	A	1: 50,928,021	L25Q	probably damaging	Het
Tmprss11g	G	T	5: 86,487,426	D396E	probably benign	Het
Tmprss11g	T	A	5: 86,487,436	H393L	probably benign	Het
Vmn2r23	A	G	6: 123,704,553	E140G	probably damaging	Het
Wapl	T	C	14: 34,677,363	S130P	probably benign	Het
Zeb2	T	A	2: 44,994,529	K982M	probably damaging	Het
Zfhx3	C	G	8: 108,956,821	H3631D	unknown	Het
Zfp719	T	C	7: 43,590,706	S573P	probably damaging	Het
Zfp979	A	T	4: 147,613,542	C237S	possibly damaging	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	161042079	missense	probably benign	0.01
IGL00899:Chd6	APN	2	161029298	splice site	probably benign
IGL01104:Chd6	APN	2	160961927	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160988370	splice site	probably benign
IGL01717:Chd6	APN	2	160965259	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160961374	missense	probably benign	0.00
IGL01814:Chd6	APN	2	161059929	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160983678	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160977512	missense	probably benign
IGL02158:Chd6	APN	2	161026292	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160965675	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160984452	splice site	probably benign
IGL02522:Chd6	APN	2	160965796	missense	probably benign	0.30
IGL02626:Chd6	APN	2	161039350	splice site	probably benign
IGL02727:Chd6	APN	2	160969463	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160965698	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160960263	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160984632	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160990301	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	161019616	nonsense	probably null
IGL02979:Chd6	APN	2	160966170	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	161052384	splice site	probably benign
IGL03277:Chd6	APN	2	160983061	missense	probably null	1.00
IGL03346:Chd6	APN	2	160960362	missense	probably benign	0.00
IGL03357:Chd6	APN	2	161018016	splice site	probably benign
IGL03134:Chd6	UTSW	2	160965483	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	161052847	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	161014324	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	161052688	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160992191	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	161019580	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	161030802	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160967815	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160983103	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160981667	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160966639	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160990256	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160968000	splice site	probably benign
R1973:Chd6	UTSW	2	160966387	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160983753	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160965759	frame shift	probably null
R2341:Chd6	UTSW	2	160965759	frame shift	probably null
R2519:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160967880	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160966552	small deletion	probably benign
R3426:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160988333	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160961291	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160949856	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160965318	missense	probably benign
R4458:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	161014194	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160969492	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160970183	missense	probably benign
R4765:Chd6	UTSW	2	160966244	nonsense	probably null
R4779:Chd6	UTSW	2	160949557	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	161029299	splice site	probably benign
R5068:Chd6	UTSW	2	160966369	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160949953	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160969363	missense	probably benign
R5405:Chd6	UTSW	2	160965390	missense	probably benign
R5598:Chd6	UTSW	2	161014112	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160965265	missense	probably benign
R5697:Chd6	UTSW	2	161018051	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160949878	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160983762	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160957078	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160957079	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160965827	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160965582	missense	probably benign
R6104:Chd6	UTSW	2	161014132	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160950048	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160979487	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160965498	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	161013067	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160966254	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160960359	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160965730	missense	probably benign
R6895:Chd6	UTSW	2	160988340	missense	probably damaging	1.00
R7061:Chd6	UTSW	2	161025965	nonsense	probably null
R7064:Chd6	UTSW	2	160950063	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160961279	nonsense	probably null
R7287:Chd6	UTSW	2	161008392	missense	probably benign	0.07
R7431:Chd6	UTSW	2	161026328	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160950003	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	161013154	missense	probably damaging	1.00
R7699:Chd6	UTSW	2	161025943	missense	probably benign	0.13
R7748:Chd6	UTSW	2	160966619	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160970175	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8261:Chd6	UTSW	2	160957082	missense	probably damaging	1.00
R8317:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8388:Chd6	UTSW	2	161019651	missense	probably damaging	1.00
R8865:Chd6	UTSW	2	161021069	missense	probably benign	0.10
R8867:Chd6	UTSW	2	161021069	missense	probably benign	0.10
R8996:Chd6	UTSW	2	160981623	missense	probably damaging	1.00
R9091:Chd6	UTSW	2	161029873	nonsense	probably null
R9270:Chd6	UTSW	2	161029873	nonsense	probably null
R9310:Chd6	UTSW	2	161039261	missense	probably damaging	1.00
R9367:Chd6	UTSW	2	161029864	missense	possibly damaging	0.83
R9438:Chd6	UTSW	2	160957158	missense	probably benign	0.01
R9756:Chd6	UTSW	2	160960339	missense	probably benign
Z1088:Chd6	UTSW	2	160966488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCGAATGGATGTTAAAGACACAC -3'
(R):5'- TTGGAGTCTGACTGCTGATCC -3'

Sequencing Primer
(F):5'- TGTTAAAGACACACACTGCCTGTAG -3'
(R):5'- GGCCGAGGAAAAGATTCT -3'

Posted On

2018-11-28