Mutagenetix > Incidental Mutations

Incidental Mutation 'R6925:Prkg2'

541077

Institutional Source

Beutler Lab

Gene Symbol

Prkg2

Ensembl Gene

ENSMUSG00000029334

Gene Name

protein kinase, cGMP-dependent, type II

Synonyms

Prkgr2, cGK-II

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_008926.4; MGI: 108173

Is this an essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R6925 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98929773-99037351 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 98966510 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124963 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031277] [ENSMUST00000161490]

Predicted Effect

probably null
Transcript: ENSMUST00000031277

SMART Domains

Protein: ENSMUSP00000031277
Gene: ENSMUSG00000029334

Domain	Start	End	E-Value	Type
coiled coil region	19	85	N/A	INTRINSIC
cNMP	168	284	2.82e-19	SMART
cNMP	286	409	3.02e-28	SMART
S_TKc	424	682	9.46e-75	SMART
S_TK_X	683	733	9.83e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000161490

SMART Domains

Protein: ENSMUSP00000124963
Gene: ENSMUSG00000029334

Domain	Start	End	E-Value	Type
coiled coil region	19	85	N/A	INTRINSIC
cNMP	168	284	2.82e-19	SMART
cNMP	286	409	3.02e-28	SMART
S_TKc	453	711	1.19e-89	SMART
S_TK_X	712	762	9.83e-4	SMART

Meta Mutation Damage Score

0.9488

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (91/91)

MGI Phenotype

Strain: 24494704
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase family of proteins. The encoded protein plays a role in the regulation of fluid balance in the intestine. A similar protein in mouse is thought to regulate differentiation and proliferation of cells in the colon. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice exhibit dwarfism, with abnormal skull morphology and short limbs and vertebrae. Defects in axial organization of the growth plates was evident as mice aged. Digestive secretion in response to enterotoxin was reduced. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	G	7: 131,222,707	Q177R	possibly damaging	Het
Acat1	A	T	9: 53,592,029	V170E	probably benign	Het
Atp2b2	T	A	6: 113,760,720	I902F	probably damaging	Het
Cacna1d	A	G	14: 30,051,637	V1697A	probably benign	Het
Ccdc14	T	A	16: 34,690,749	F31Y	probably benign	Het
Ccdc17	T	A	4: 116,598,210	V250E	probably damaging	Het
Cct7	A	G	6: 85,459,182	N25S	probably damaging	Het
Cep19	G	C	16: 32,103,942	G9R	probably damaging	Het
Ces5a	A	T	8: 93,523,057		probably null	Het
Chd1l	T	G	3: 97,582,826	E471A	probably damaging	Het
Chd6	A	G	2: 161,013,127	I787T	probably damaging	Het
Cntnap5c	A	C	17: 58,395,266	T1194P	probably benign	Het
Col6a3	T	A	1: 90,816,002	M208L	probably benign	Het
Coro7	A	T	16: 4,628,674		probably null	Het
Csrnp2	T	C	15: 100,481,958	K484R	probably benign	Het
Cyp2c39	T	A	19: 39,513,195	V64E	probably damaging	Het
Ddr2	T	C	1: 169,998,132	K300E	probably benign	Het
Ddx56	T	C	11: 6,263,980	E393G	probably damaging	Het
Diaph1	A	C	18: 37,853,679	Y1084*	probably null	Het
Disp1	A	T	1: 183,086,478	F1459L	probably benign	Het
Dnajc8	G	A	4: 132,544,113	A80T	probably damaging	Het
Elfn1	T	A	5: 139,971,685	M148K	probably benign	Het
Emcn	T	A	3: 137,419,002	I154N	probably damaging	Het
Enah	C	G	1: 181,905,898		probably null	Het
Enah	T	A	1: 181,905,899		probably null	Het
Ep300	C	A	15: 81,649,981	Q2080K	probably benign	Het
Epha2	T	A	4: 141,308,757	M168K	probably benign	Het
Ercc6	T	A	14: 32,562,608	I776N	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fat4	G	T	3: 38,996,204		probably null	Het
G3bp1	A	G	11: 55,497,960	R333G	possibly damaging	Het
Gm3604	A	G	13: 62,369,390	F385L	probably benign	Het
Gm5800	T	C	14: 51,713,700	I147M	possibly damaging	Het
Hipk1	A	G	3: 103,778,245	F18S	unknown	Het
Ighv3-8	A	T	12: 114,322,330	C131S	probably benign	Het
Il23r	T	G	6: 67,423,493	T618P	probably damaging	Het
Il31ra	G	A	13: 112,527,529	T538I	possibly damaging	Het
Kcns2	A	G	15: 34,839,913	D474G	unknown	Het
Klc4	T	C	17: 46,636,229	T407A	possibly damaging	Het
Klra5	C	T	6: 129,911,457	S2N	probably benign	Het
Krt10	T	C	11: 99,388,851	Y161C	probably damaging	Het
Kxd1	A	T	8: 70,523,278	M1K	probably null	Het
Lgals1	A	C	15: 78,928,040	D27A	possibly damaging	Het
Lgr5	T	C	10: 115,466,346	S308G	probably benign	Het
Lrp1	G	A	10: 127,556,988	S2736L	probably benign	Het
Lrpap1	G	T	5: 35,102,536	H73N	probably benign	Het
Mcpt1	C	A	14: 56,019,065	T86K	probably damaging	Het
Megf6	A	T	4: 154,254,587	D527V	probably damaging	Het
Mical3	A	T	6: 120,959,390	S1392T	probably benign	Het
Mmp2	A	T	8: 92,839,382	D437V	probably damaging	Het
Mob4	T	A	1: 55,152,722	Y166*	probably null	Het
Mrap2	G	A	9: 87,182,474	M89I	possibly damaging	Het
Mug1	G	A	6: 121,881,787	A1155T	probably damaging	Het
Myh2	G	T	11: 67,193,218	A1556S	probably benign	Het
Nfatc3	A	G	8: 106,119,322	D1028G	probably benign	Het
Ngef	T	G	1: 87,503,263		probably null	Het
Nlrp1a	A	T	11: 71,092,513	L1209Q	probably null	Het
Npr2	C	T	4: 43,647,553	R819C	probably damaging	Het
Nsd2	A	T	5: 33,879,110	D646V	probably damaging	Het
Nsun7	A	G	5: 66,277,072	H252R	probably damaging	Het
Olfr267	A	T	4: 58,785,647	I25N	possibly damaging	Het
Olfr447	T	A	6: 42,911,857	C111*	probably null	Het
Olfr642	C	T	7: 104,049,740	V205I	probably benign	Het
Olfr951	A	T	9: 39,393,860	Q20L	probably benign	Het
Olfr951	G	T	9: 39,393,861	Q20H	probably benign	Het
Pcdhga2	A	T	18: 37,670,585	D494V	probably damaging	Het
Pcsk2	A	G	2: 143,813,747	E617G	probably damaging	Het
Pdc	T	C	1: 150,333,180	I138T	probably damaging	Het
Phc2	T	A	4: 128,748,134	S750T	probably damaging	Het
Pkd2l1	T	A	19: 44,191,508	N88Y	possibly damaging	Het
Plcl1	C	T	1: 55,406,598	R71*	probably null	Het
Prag1	C	A	8: 36,103,894	L544M	probably damaging	Het
Psd2	G	A	18: 35,979,711	S153N	probably damaging	Het
Rab11fip1	A	T	8: 27,152,972	S600T	probably damaging	Het
Rbms1	T	G	2: 60,762,304	T222P	probably benign	Het
Slfn8	A	T	11: 83,013,417	Y382*	probably null	Het
Socs4	T	A	14: 47,289,738	C43*	probably null	Het
Sorl1	T	A	9: 42,033,626	T868S	probably damaging	Het
St6gal1	A	G	16: 23,356,213	Y267C	probably damaging	Het
Syne1	A	G	10: 5,126,682	V6879A	probably benign	Het
Syne2	C	A	12: 75,854,132	H22N	possibly damaging	Het
Tmeff2	T	A	1: 50,928,021	L25Q	probably damaging	Het
Tmprss11g	G	T	5: 86,487,426	D396E	probably benign	Het
Tmprss11g	T	A	5: 86,487,436	H393L	probably benign	Het
Vmn2r23	A	G	6: 123,704,553	E140G	probably damaging	Het
Wapl	T	C	14: 34,677,363	S130P	probably benign	Het
Zeb2	T	A	2: 44,994,529	K982M	probably damaging	Het
Zfhx3	C	G	8: 108,956,821	H3631D	unknown	Het
Zfp719	T	C	7: 43,590,706	S573P	probably damaging	Het
Zfp979	A	T	4: 147,613,542	C237S	possibly damaging	Het

Other mutations in Prkg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Prkg2	APN	5	99024541	missense	probably benign	0.00
IGL01063:Prkg2	APN	5	98969936	critical splice donor site	probably null
IGL02060:Prkg2	APN	5	99024515	missense	probably benign	0.32
IGL02666:Prkg2	APN	5	98997519	splice site	probably benign
IGL02992:Prkg2	APN	5	99024506	missense	probably benign
IGL03040:Prkg2	APN	5	98973107	critical splice donor site	probably null
devito	UTSW	5	98966510	critical splice donor site	probably null
P0005:Prkg2	UTSW	5	98969947	missense	probably damaging	1.00
R0044:Prkg2	UTSW	5	98973130	missense	probably damaging	0.98
R0044:Prkg2	UTSW	5	98973130	missense	probably damaging	0.98
R0115:Prkg2	UTSW	5	98994655	splice site	probably null
R0403:Prkg2	UTSW	5	98994645	missense	possibly damaging	0.95
R0452:Prkg2	UTSW	5	98997520	splice site	probably benign
R0481:Prkg2	UTSW	5	98994655	splice site	probably null
R1194:Prkg2	UTSW	5	98971926	missense	probably benign	0.00
R1534:Prkg2	UTSW	5	98994561	missense	probably damaging	1.00
R1861:Prkg2	UTSW	5	98947416	missense	probably damaging	1.00
R2010:Prkg2	UTSW	5	99024805	missense	probably benign
R2031:Prkg2	UTSW	5	99024451	missense	possibly damaging	0.85
R2176:Prkg2	UTSW	5	98966509	splice site	probably benign
R3607:Prkg2	UTSW	5	98947377	missense	probably damaging	1.00
R3958:Prkg2	UTSW	5	98997495	missense	possibly damaging	0.84
R3960:Prkg2	UTSW	5	98997495	missense	possibly damaging	0.84
R4012:Prkg2	UTSW	5	98979815	missense	possibly damaging	0.93
R4794:Prkg2	UTSW	5	98966633	missense	probably damaging	1.00
R4840:Prkg2	UTSW	5	98981143	missense	probably benign	0.03
R4867:Prkg2	UTSW	5	99024709	missense	probably benign	0.21
R5182:Prkg2	UTSW	5	99024709	missense	probably benign	0.21
R5226:Prkg2	UTSW	5	98976462	missense	possibly damaging	0.92
R5274:Prkg2	UTSW	5	98969991	missense	probably damaging	1.00
R5416:Prkg2	UTSW	5	98943467	missense	probably benign	0.05
R5531:Prkg2	UTSW	5	98967734	missense	probably damaging	1.00
R5619:Prkg2	UTSW	5	98988297	missense	probably damaging	1.00
R6264:Prkg2	UTSW	5	98934364	missense	probably benign	0.22
Z1088:Prkg2	UTSW	5	99024804	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAGGCAGTTCCTATATGGAGTGC -3'
(R):5'- GGCACCATGGACGTATTCAG -3'

Sequencing Primer
(F):5'- TGGAAGCTCACAACTGTCTG -3'
(R):5'- CCATGGACGTATTCAGAGTATTAAG -3'

Posted On

2018-11-28